ID: 1053478240

View in Genome Browser
Species Human (GRCh38)
Location 9:38397163-38397185
Sequence GTGGCAGGTGACGATGTTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 10, 3: 17, 4: 120}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053478240_1053478249 12 Left 1053478240 9:38397163-38397185 CCTACAACATCGTCACCTGCCAC 0: 1
1: 0
2: 10
3: 17
4: 120
Right 1053478249 9:38397198-38397220 GGGTTTAAGGAATCTGGAAACGG 0: 1
1: 0
2: 3
3: 21
4: 253
1053478240_1053478254 24 Left 1053478240 9:38397163-38397185 CCTACAACATCGTCACCTGCCAC 0: 1
1: 0
2: 10
3: 17
4: 120
Right 1053478254 9:38397210-38397232 TCTGGAAACGGGAGGGAGCTGGG 0: 1
1: 2
2: 2
3: 14
4: 258
1053478240_1053478250 13 Left 1053478240 9:38397163-38397185 CCTACAACATCGTCACCTGCCAC 0: 1
1: 0
2: 10
3: 17
4: 120
Right 1053478250 9:38397199-38397221 GGTTTAAGGAATCTGGAAACGGG 0: 1
1: 0
2: 4
3: 13
4: 175
1053478240_1053478248 6 Left 1053478240 9:38397163-38397185 CCTACAACATCGTCACCTGCCAC 0: 1
1: 0
2: 10
3: 17
4: 120
Right 1053478248 9:38397192-38397214 TTTGGAGGGTTTAAGGAATCTGG 0: 1
1: 0
2: 2
3: 29
4: 218
1053478240_1053478251 16 Left 1053478240 9:38397163-38397185 CCTACAACATCGTCACCTGCCAC 0: 1
1: 0
2: 10
3: 17
4: 120
Right 1053478251 9:38397202-38397224 TTAAGGAATCTGGAAACGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 119
1053478240_1053478246 -1 Left 1053478240 9:38397163-38397185 CCTACAACATCGTCACCTGCCAC 0: 1
1: 0
2: 10
3: 17
4: 120
Right 1053478246 9:38397185-38397207 CACGCCATTTGGAGGGTTTAAGG 0: 1
1: 0
2: 0
3: 7
4: 71
1053478240_1053478242 -9 Left 1053478240 9:38397163-38397185 CCTACAACATCGTCACCTGCCAC 0: 1
1: 0
2: 10
3: 17
4: 120
Right 1053478242 9:38397177-38397199 ACCTGCCACACGCCATTTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 53
1053478240_1053478252 17 Left 1053478240 9:38397163-38397185 CCTACAACATCGTCACCTGCCAC 0: 1
1: 0
2: 10
3: 17
4: 120
Right 1053478252 9:38397203-38397225 TAAGGAATCTGGAAACGGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 199
1053478240_1053478253 23 Left 1053478240 9:38397163-38397185 CCTACAACATCGTCACCTGCCAC 0: 1
1: 0
2: 10
3: 17
4: 120
Right 1053478253 9:38397209-38397231 ATCTGGAAACGGGAGGGAGCTGG 0: 1
1: 0
2: 7
3: 42
4: 405
1053478240_1053478255 29 Left 1053478240 9:38397163-38397185 CCTACAACATCGTCACCTGCCAC 0: 1
1: 0
2: 10
3: 17
4: 120
Right 1053478255 9:38397215-38397237 AAACGGGAGGGAGCTGGGTGAGG 0: 1
1: 0
2: 7
3: 57
4: 719
1053478240_1053478244 -8 Left 1053478240 9:38397163-38397185 CCTACAACATCGTCACCTGCCAC 0: 1
1: 0
2: 10
3: 17
4: 120
Right 1053478244 9:38397178-38397200 CCTGCCACACGCCATTTGGAGGG 0: 1
1: 0
2: 1
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053478240 Original CRISPR GTGGCAGGTGACGATGTTGT AGG (reversed) Exonic
900945560 1:5829513-5829535 GTGGGAGGTGATGATGGTGCTGG + Intergenic
902318023 1:15638467-15638489 GTGTCAGGTAAAGATGTTGGAGG - Intronic
902856478 1:19210034-19210056 CTGGCGGGCGACGCTGTTGTGGG - Intronic
908900386 1:68949801-68949823 GATGCTGGTGACAATGTTGTTGG + Intergenic
911218254 1:95218906-95218928 GTGGGGAGTGACGATGTTGTAGG + Intronic
920940974 1:210481996-210482018 GTGGCAGGAGACGAGGGTGGGGG + Intronic
1065162866 10:22941215-22941237 GAGGCAGGAGAGAATGTTGTGGG + Intronic
1066201679 10:33147805-33147827 GTGGGAGGTGTCTTTGTTGTGGG + Intergenic
1067245346 10:44536809-44536831 GTGGCAGGTGAAGACTGTGTGGG - Intergenic
1071611086 10:87031499-87031521 GTGACAGGTGACAATGTGCTGGG - Intergenic
1074228941 10:111514694-111514716 GTGGCAGGAGCAGATGTGGTTGG - Intergenic
1076795380 10:132795551-132795573 GTGGGAGCTGACGGAGTTGTGGG + Intergenic
1080410090 11:32015162-32015184 GTGGCAGGAGAGAATGTTCTAGG - Intronic
1081369103 11:42276806-42276828 GTGGGAGGTGACTGTGTTATAGG - Intergenic
1081531383 11:43962058-43962080 GTGGAAGGTGTCCATGTTCTGGG - Intergenic
1082856957 11:57816844-57816866 GTGGCATGTGCCAATGTTGCTGG - Exonic
1084275115 11:68047436-68047458 GGGGAAGGTGATGATGGTGTAGG - Exonic
1084406740 11:68978645-68978667 GTGGCAGGTGATGGTGTCCTGGG - Intergenic
1085034480 11:73291914-73291936 GTGGCATGGGAGGATGGTGTGGG - Intronic
1092152740 12:6262337-6262359 GAGGCAGGTGCCTGTGTTGTGGG - Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1095775455 12:46004676-46004698 GTGGCTGTTGAAGATGTTGAAGG - Intergenic
1096213020 12:49780822-49780844 ATGGCAGGAGAAGATGTTGGAGG - Intergenic
1099043231 12:77682116-77682138 GTGGCAGGGGACCAGGGTGTGGG - Intergenic
1100039141 12:90291199-90291221 GTGGGAGGTGTCTAGGTTGTGGG - Intergenic
1102166088 12:110807918-110807940 GTGCCAGGTGAGGCTGTTCTAGG + Intergenic
1116068078 14:40009058-40009080 GTGGCAGATAGGGATGTTGTTGG + Intergenic
1119086935 14:71747643-71747665 ATGGTAGGTGAGGGTGTTGTCGG + Intergenic
1125790367 15:42361037-42361059 TTGTCAGGAGACGATGTTCTGGG + Intronic
1129622277 15:77158964-77158986 GTGGGAGGTGGTGATGTTGGTGG + Intronic
1137312023 16:47272282-47272304 GTGGCAGTGGACGAAGTCGTAGG + Intronic
1138805343 16:60083924-60083946 GTGGTAAGGGGCGATGTTGTGGG - Intergenic
1139581137 16:67874265-67874287 GTGGCCGGTGATGATGGTGTGGG + Intronic
1140944825 16:79758143-79758165 GTGGCAGGTGAGGACGATGGGGG + Intergenic
1144043926 17:11437916-11437938 GGGGCTGGTGATGATGATGTTGG + Intronic
1147359145 17:39920512-39920534 GTGGCAGGGGAAGAGGTTCTGGG - Intergenic
1149207071 17:54260693-54260715 GTGGCATGTGACCATATTATAGG + Intergenic
1149894198 17:60416444-60416466 CTGGCAGGTGAGGGGGTTGTGGG - Intronic
1152634464 17:81425009-81425031 GTGGTTGGTGATGATGTGGTTGG + Intronic
1152634628 17:81425683-81425705 GTGGTTGGTGGCGATGTGGTTGG + Intronic
1152634687 17:81425985-81426007 GTGGTTGGTGATGATGTGGTTGG + Intronic
1152634736 17:81426198-81426220 GTGGTTGGTGATGATGTGGTTGG + Intronic
1153467704 18:5407579-5407601 GTAGCTGGTTACCATGTTGTTGG - Intronic
1159010820 18:63057575-63057597 GTGGCAGGTTAAGATGCTGTGGG - Intergenic
1160382654 18:78472358-78472380 GAGGCAGGTGACGATGGGGCGGG - Intergenic
1165116893 19:33533942-33533964 GTGGCAGGTGGAGAAGCTGTGGG + Intergenic
1165855634 19:38878113-38878135 GTGGCAGGAGAGGAGGCTGTGGG + Intronic
1167566728 19:50261584-50261606 CTGGAAGGAGACGATGATGTCGG - Exonic
1167660646 19:50794134-50794156 GAGGGAGGTGACGGTGTTATGGG + Intronic
925717377 2:6796825-6796847 GGGGCAGGTGAGGATGCTGAGGG - Intergenic
935034845 2:99359579-99359601 TTGGTAGGTGACGACATTGTTGG + Intronic
935178240 2:100668161-100668183 GTTGCAGGTGAAGATTTTGAAGG + Intergenic
936032952 2:109086850-109086872 GTTGCAGGTAAAGATGATGTGGG - Intergenic
936513122 2:113164552-113164574 GTGCCAGGTGAAGATTTTCTAGG + Intronic
937426372 2:121802574-121802596 GTGGCAGGTGGAGATGATGGAGG + Intergenic
940256670 2:151738343-151738365 GTAGCAGGTGGCGATGGTATTGG + Intergenic
943734173 2:191335807-191335829 TTGGCAGATGATGATGTTATTGG + Intronic
945185103 2:207132522-207132544 GTGGGTGGTGAGGATGTTGGAGG + Intronic
945662108 2:212699014-212699036 GTGGTAAGTGAGAATGTTGTTGG + Intergenic
947758854 2:232588660-232588682 GGGGCTGGTGAGGATGTTGCAGG - Intergenic
1172301274 20:33852242-33852264 GTGGCAGGTGATCTTGTGGTCGG + Intronic
1172761837 20:37328585-37328607 GGGGCAGGTGGCCATGTTGGAGG + Intergenic
1172891731 20:38270783-38270805 GTGGCAGGAGAGCATGTTGGAGG + Intronic
1175963161 20:62647267-62647289 GAGGCAGCTGAAGATGGTGTGGG + Intronic
1179495746 21:41770209-41770231 GTGGCAGGAGTGGCTGTTGTAGG - Intergenic
1180207013 21:46267002-46267024 GTGGCAGGTGAGGAAGTCGGTGG + Exonic
954646506 3:52134965-52134987 CTGGGAGGTGGCGATGTGGTGGG - Intronic
954773838 3:52998814-52998836 GTGGTAGCTGAAGACGTTGTGGG - Intronic
955463902 3:59216115-59216137 GTGGGAGATGAGGATGTGGTGGG + Intergenic
965516547 3:169628092-169628114 GTGGCAGGTGACAATATTCTTGG - Intronic
966914212 3:184575914-184575936 GTGGCAGGTGCAGATGCTGGCGG - Exonic
976215601 4:82712640-82712662 GTGGCAGGTGCTGATGCTGCTGG + Intronic
978525802 4:109663925-109663947 GTGGCAGGTGACAGTTTTGGGGG - Intronic
979746840 4:124225790-124225812 GGGGCAGGGGAAGATGTTATGGG - Intergenic
981220097 4:142221854-142221876 GTGGCAAGTGACTATGGTATGGG + Intronic
985011494 4:185587495-185587517 GTGGCAGGTGGAGATGGTGACGG + Exonic
985645050 5:1080839-1080861 GTGTCAGGAGAAGCTGTTGTAGG - Intronic
985714785 5:1449473-1449495 GTGGCAGACGGAGATGTTGTAGG + Intergenic
986732598 5:10646239-10646261 GTGGGAGATGACGATGCTGGGGG + Intronic
986878795 5:12144188-12144210 GTGGCAGGTGACTGAATTGTGGG + Intergenic
992251803 5:74883334-74883356 GTGGCAAGGGGCGATATTGTGGG + Intergenic
994165285 5:96601888-96601910 GTGGCAGGTGACTATACTTTTGG - Intronic
997617884 5:135264913-135264935 GTGGCAGGCGAGGCTGTTGAAGG + Intronic
997923388 5:138004507-138004529 GTGGCAAGTGACTATCATGTTGG - Intronic
999522326 5:152363646-152363668 GTGATAGATGACAATGTTGTAGG + Intergenic
999858536 5:155620863-155620885 GTGGTAGGTGACGAGGCTGGGGG + Intergenic
1002027363 5:176404648-176404670 GTGGCAGGTGGCGGAGATGTGGG - Intronic
1003807177 6:9738221-9738243 GTGGCAGGTCAGGATGCTGTGGG - Intronic
1005003308 6:21264039-21264061 GTGGTAGCTGAAGGTGTTGTGGG + Intergenic
1005876465 6:30013714-30013736 CTGGCAGGTGCCGATGTTGATGG - Intergenic
1007655003 6:43446524-43446546 GTGGGAGGTGAAAATGTTGGGGG - Intronic
1007969880 6:46040612-46040634 GTGGTGGATGACGATGTTGTTGG + Intronic
1008502867 6:52200770-52200792 GTGGGAAGTCAGGATGTTGTGGG - Intergenic
1016536296 6:145110356-145110378 GTGGTAGGTGAAGTTGGTGTTGG + Intergenic
1017721038 6:157243380-157243402 GTGGTAGGTGACCTTGTTATAGG - Intergenic
1017724981 6:157270478-157270500 GTTGGTGGTGATGATGTTGTTGG - Intergenic
1025004687 7:55344720-55344742 GGTGCGGGTGACGATGGTGTTGG - Intergenic
1028064066 7:86359942-86359964 GTGGCAGATGATGATTGTGTGGG + Intergenic
1028372181 7:90105237-90105259 GTGGCTGGTGACTATGGTATTGG - Intergenic
1029865570 7:103624376-103624398 GTGGTATGTGACGATGTGGTGGG - Intronic
1032955960 7:136972752-136972774 GTGGCAGGTGACGATGGTGACGG + Intronic
1032955967 7:136972786-136972808 GTGGCAGGTGACGATGGTGACGG + Intronic
1032955974 7:136972820-136972842 GTGGCAGGTGACGATGGTGACGG + Intronic
1032955981 7:136972854-136972876 GTGGCAGGTGACGATGGTGACGG + Intronic
1032955988 7:136972888-136972910 GTGGCAGGTGACGATGGTGACGG + Intronic
1032955995 7:136972922-136972944 GTGGCAGGTGACGATGGTGACGG + Intronic
1032956002 7:136972956-136972978 GTGGCAGGTGACGATGGTGACGG + Intronic
1032956009 7:136972990-136973012 GTGGCAGGTGACGATGGTGACGG + Intronic
1032956016 7:136973024-136973046 GTGGCAGGTGACGATGGTGACGG + Intronic
1032956023 7:136973058-136973080 GTGGCAGGTGACGATGGTGACGG + Intronic
1032956030 7:136973092-136973114 GTGGCAGGTGATGATGGTGACGG + Intronic
1032956037 7:136973126-136973148 GTGGCAGGTGATGATGGTGACGG + Intronic
1032956044 7:136973160-136973182 GTGGCAGGTGATGATGGTGACGG + Intronic
1032956056 7:136973215-136973237 GTGGCAGGTGATGATGGTGACGG + Intronic
1032956063 7:136973249-136973271 GTGGCAGGTGATGATGGTGACGG + Intronic
1032956070 7:136973283-136973305 GTGGCAGGTGATGATGGTGACGG + Intronic
1032956084 7:136973348-136973370 GTGGCAGGTGATGACGGTGACGG + Intronic
1032956091 7:136973382-136973404 GTGGCAGGTGATGACGGTGACGG + Intronic
1032956098 7:136973416-136973438 GTGGCAGGTGATGACGGTGACGG + Intronic
1032956105 7:136973450-136973472 GTGGCAGGTGATGACGGTGACGG + Intronic
1032956147 7:136973654-136973676 GTGGTAGGTGATGATGGTGATGG + Intronic
1033096320 7:138434487-138434509 GTGGCAGGTGTCCAGGTTCTTGG - Intergenic
1035713611 8:1737471-1737493 GTGGGAGGTGACTGTGTTGTGGG - Intergenic
1036037513 8:5035529-5035551 GCGGCAGATGTCGATATTGTGGG - Intergenic
1036617219 8:10397736-10397758 GTGGAACATGAAGATGTTGTTGG + Intronic
1042642448 8:70951347-70951369 GTGGCAGCTGCCAAGGTTGTGGG + Intergenic
1047539667 8:125752385-125752407 GTTGTAGGTGAGGCTGTTGTAGG + Intergenic
1049286614 8:141779048-141779070 GTGGCTGTTGCCCATGTTGTTGG + Intergenic
1049957987 9:711168-711190 GTGGCAGCTGTCGATTTTCTGGG - Exonic
1050253624 9:3771596-3771618 ATGGCAGAGGAGGATGTTGTGGG + Intergenic
1051274594 9:15386784-15386806 GTGGCAGGTGACGGGATCGTGGG + Intergenic
1053365265 9:37518302-37518324 GTTGCAGGAGATGCTGTTGTTGG + Exonic
1053478240 9:38397163-38397185 GTGGCAGGTGACGATGTTGTAGG - Exonic
1054777025 9:69132400-69132422 GTGGCAGGTGAGGATGGTGGTGG + Intronic
1056874818 9:90317987-90318009 GTAGCAGGAGAGGATGTTATGGG - Intergenic
1060730571 9:126034266-126034288 ATGGCAGGTGAAGAGGTTTTTGG + Intergenic
1060744728 9:126123700-126123722 GTGGCAGCTGAGGCTGTTGGTGG + Intergenic
1061536888 9:131255840-131255862 GTGGGAGGTGGAGATGTTATGGG + Intergenic
1061996289 9:134187863-134187885 GTTGGTGGTGACGATGCTGTAGG + Intergenic
1062121210 9:134835047-134835069 GTGGTAGGTGACGTTCTGGTGGG - Exonic
1185731761 X:2467397-2467419 GAGGCTGGTGAGGATGCTGTGGG - Intronic
1185732539 X:2473097-2473119 GAGGCTGGTGAGGATGCTGTGGG - Intronic
1185733141 X:2477319-2477341 GAGGCTGGTGAGGATGCTGTGGG - Intronic
1186540094 X:10391618-10391640 GTGGCAGGTGGAGATGTTAAGGG + Intergenic
1187046585 X:15653440-15653462 GTGGCAGCTGAGGATGCTATGGG - Intronic
1190798002 X:53761649-53761671 GTGGCAGGAGAAGGTGTTATGGG - Intergenic
1198641614 X:138762129-138762151 GTGGCAGGTGCCTATCTTATTGG + Intronic
1199993014 X:153000008-153000030 TTGGCAGGTGACAAATTTGTGGG + Intergenic