ID: 1053479203

View in Genome Browser
Species Human (GRCh38)
Location 9:38403440-38403462
Sequence CTTATGTAACAGTCTAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053479200_1053479203 18 Left 1053479200 9:38403399-38403421 CCCCAAATTTGAGGGTTCAATAC No data
Right 1053479203 9:38403440-38403462 CTTATGTAACAGTCTAATGCAGG No data
1053479202_1053479203 16 Left 1053479202 9:38403401-38403423 CCAAATTTGAGGGTTCAATACGA No data
Right 1053479203 9:38403440-38403462 CTTATGTAACAGTCTAATGCAGG No data
1053479201_1053479203 17 Left 1053479201 9:38403400-38403422 CCCAAATTTGAGGGTTCAATACG No data
Right 1053479203 9:38403440-38403462 CTTATGTAACAGTCTAATGCAGG No data
1053479199_1053479203 19 Left 1053479199 9:38403398-38403420 CCCCCAAATTTGAGGGTTCAATA No data
Right 1053479203 9:38403440-38403462 CTTATGTAACAGTCTAATGCAGG No data
1053479198_1053479203 20 Left 1053479198 9:38403397-38403419 CCCCCCAAATTTGAGGGTTCAAT No data
Right 1053479203 9:38403440-38403462 CTTATGTAACAGTCTAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053479203 Original CRISPR CTTATGTAACAGTCTAATGC AGG Intergenic
No off target data available for this crispr