ID: 1053479284

View in Genome Browser
Species Human (GRCh38)
Location 9:38404019-38404041
Sequence GGGGTTTTCACTTGGATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053479284_1053479295 19 Left 1053479284 9:38404019-38404041 CCAGGGATCCAAGTGAAAACCCC No data
Right 1053479295 9:38404061-38404083 CTCCGTGTCAGCTGGTAAATGGG No data
1053479284_1053479293 11 Left 1053479284 9:38404019-38404041 CCAGGGATCCAAGTGAAAACCCC No data
Right 1053479293 9:38404053-38404075 TCAGAGATCTCCGTGTCAGCTGG No data
1053479284_1053479294 18 Left 1053479284 9:38404019-38404041 CCAGGGATCCAAGTGAAAACCCC No data
Right 1053479294 9:38404060-38404082 TCTCCGTGTCAGCTGGTAAATGG No data
1053479284_1053479296 20 Left 1053479284 9:38404019-38404041 CCAGGGATCCAAGTGAAAACCCC No data
Right 1053479296 9:38404062-38404084 TCCGTGTCAGCTGGTAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053479284 Original CRISPR GGGGTTTTCACTTGGATCCC TGG (reversed) Intergenic
No off target data available for this crispr