ID: 1053479509

View in Genome Browser
Species Human (GRCh38)
Location 9:38405577-38405599
Sequence CCCTCTCCTCCAGGGACGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053479509_1053479515 3 Left 1053479509 9:38405577-38405599 CCATCCGTCCCTGGAGGAGAGGG No data
Right 1053479515 9:38405603-38405625 GACAGTGTTTTTAAAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053479509 Original CRISPR CCCTCTCCTCCAGGGACGGA TGG (reversed) Intergenic
No off target data available for this crispr