ID: 1053480640

View in Genome Browser
Species Human (GRCh38)
Location 9:38414150-38414172
Sequence TCACAACGTCACCGGGGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 38}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480640_1053480651 19 Left 1053480640 9:38414150-38414172 CCTGCGCCCCGGTGACGTTGTGA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1053480651 9:38414192-38414214 CGACCACAGGAGCTAGGAGGAGG 0: 1
1: 0
2: 2
3: 16
4: 191
1053480640_1053480649 13 Left 1053480640 9:38414150-38414172 CCTGCGCCCCGGTGACGTTGTGA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1053480649 9:38414186-38414208 GAACGACGACCACAGGAGCTAGG 0: 1
1: 0
2: 1
3: 8
4: 48
1053480640_1053480648 6 Left 1053480640 9:38414150-38414172 CCTGCGCCCCGGTGACGTTGTGA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1053480648 9:38414179-38414201 CGGGGAGGAACGACGACCACAGG 0: 1
1: 0
2: 1
3: 1
4: 51
1053480640_1053480653 27 Left 1053480640 9:38414150-38414172 CCTGCGCCCCGGTGACGTTGTGA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1053480653 9:38414200-38414222 GGAGCTAGGAGGAGGAGACAAGG 0: 1
1: 0
2: 5
3: 79
4: 742
1053480640_1053480650 16 Left 1053480640 9:38414150-38414172 CCTGCGCCCCGGTGACGTTGTGA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1053480650 9:38414189-38414211 CGACGACCACAGGAGCTAGGAGG 0: 1
1: 0
2: 3
3: 3
4: 39
1053480640_1053480647 -9 Left 1053480640 9:38414150-38414172 CCTGCGCCCCGGTGACGTTGTGA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1053480647 9:38414164-38414186 ACGTTGTGAACACTTCGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480640 Original CRISPR TCACAACGTCACCGGGGCGC AGG (reversed) Exonic
908127176 1:61043393-61043415 CCACGACGGCAGCGGGGCGCGGG + Intronic
919888919 1:201955763-201955785 TCACAAGGTCACACGGGTGCTGG - Intronic
1063383463 10:5601382-5601404 TCACAAGGTCACCTGGACACCGG + Intergenic
1103914455 12:124369336-124369358 TCCCAAAGTCACCGGGGCGGGGG + Intronic
1113971735 13:114196424-114196446 GCGGAACGTCAGCGGGGCGCGGG - Intergenic
1119471940 14:74905929-74905951 TCACCCTGTCACCGGGGCGTGGG - Exonic
1123063837 14:105606406-105606428 ACACAGCCTCACCGGGGCCCGGG - Intergenic
1130403056 15:83574759-83574781 GCAAAACGTCACCAGGGAGCTGG - Intronic
1132936755 16:2485078-2485100 TCACAACATCACAGAGGTGCTGG - Intronic
1137015512 16:35370330-35370352 TCACAATGTCACCTGCGTGCTGG + Intergenic
1137027986 16:35497704-35497726 TCACAACATCACCTGTGCTCTGG + Intergenic
1140223906 16:73063962-73063984 CCAGAACGTCACCTGGGCGCGGG - Intergenic
1148022936 17:44565645-44565667 TGACAAGGTCACCAGGGCTCAGG - Intergenic
1154194382 18:12254852-12254874 TCACAACGGGAGCTGGGCGCGGG + Intronic
1157609750 18:48949084-48949106 CGACAACGTCACTGAGGCGCCGG + Intronic
1158473743 18:57761401-57761423 TCACATCCTCACCTGGGCTCAGG + Intronic
1159005313 18:63005354-63005376 TCACAGTGTCACCGAGGAGCTGG + Intergenic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160793378 19:933114-933136 TCACCACGTCACCAAGGCCCCGG - Intronic
1160911182 19:1474494-1474516 TCACAACGACCCTGGGCCGCTGG - Exonic
1161189382 19:2944694-2944716 TGACCACGTCCCCGGGGCCCAGG + Intronic
1163282090 19:16324555-16324577 TGACAACGTCGCCGGGGAGACGG + Intergenic
1164041385 19:21495699-21495721 TCACAATGTCACCTGTGTGCTGG - Intergenic
1164295505 19:23906110-23906132 TCACAATGTCACCTGTGTGCTGG - Intergenic
1164313939 19:24070303-24070325 TCACAATGTCACCTGTGTGCTGG - Intronic
1165230061 19:34381233-34381255 GCACAACGTCACTGGCGTGCTGG + Intronic
1184391446 22:44205759-44205781 GCACAACGTCACCCTGGCGCTGG + Exonic
950115067 3:10445502-10445524 TCACAGCCTCACAGGGGGGCAGG + Intronic
960225957 3:115168856-115168878 TCACAAGTTCACCGGAGAGCTGG - Intergenic
982301764 4:153886006-153886028 TCACAAGGTCAGCTGGGCACAGG + Intergenic
983794225 4:171840122-171840144 ACACAAAGTCACCGGCTCGCTGG + Intronic
1000037026 5:157456647-157456669 TCACAACCTCACTGGGCCTCAGG - Intronic
1011591096 6:88971633-88971655 TGACAAGGTCACCGGGACGCAGG + Intergenic
1035602274 8:903693-903715 CCATAACATCACCGGGGTGCGGG - Intergenic
1036494318 8:9255685-9255707 TCACAATGTCATCGGGACCCTGG + Intergenic
1040382226 8:46884110-46884132 TCACAATGTCCCCTGGGGGCAGG + Intergenic
1049252055 8:141594473-141594495 TCACAAGGCCACTGGGGTGCAGG - Intergenic
1053275506 9:36780411-36780433 TCACTCAGTCACTGGGGCGCTGG + Intergenic
1053480640 9:38414150-38414172 TCACAACGTCACCGGGGCGCAGG - Exonic
1060767684 9:126307260-126307282 TCACACAGTCACAGGGGCCCAGG - Intergenic
1202245669 Y:22817781-22817803 TCACAATGTCACCTGTGGGCAGG - Intergenic
1202398658 Y:24451529-24451551 TCACAATGTCACCTGTGGGCAGG - Intergenic
1202472123 Y:25218557-25218579 TCACAATGTCACCTGTGGGCAGG + Intergenic