ID: 1053480739

View in Genome Browser
Species Human (GRCh38)
Location 9:38414625-38414647
Sequence CCTTCCACGTGGAGGGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480732_1053480739 12 Left 1053480732 9:38414590-38414612 CCAACGGCAGAGTCTTCTAACAG 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1053480739 9:38414625-38414647 CCTTCCACGTGGAGGGTGTTAGG No data
1053480731_1053480739 15 Left 1053480731 9:38414587-38414609 CCACCAACGGCAGAGTCTTCTAA 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1053480739 9:38414625-38414647 CCTTCCACGTGGAGGGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480739 Original CRISPR CCTTCCACGTGGAGGGTGTT AGG Intronic
No off target data available for this crispr