ID: 1053480957

View in Genome Browser
Species Human (GRCh38)
Location 9:38415865-38415887
Sequence GAGGGGGAGGAAAGCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 587}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480957_1053480967 17 Left 1053480957 9:38415865-38415887 CCCAGGCTGCTTTCCTCCCCCTC 0: 1
1: 0
2: 6
3: 69
4: 587
Right 1053480967 9:38415905-38415927 CATTCAGCTGTACCCATCTGAGG No data
1053480957_1053480968 18 Left 1053480957 9:38415865-38415887 CCCAGGCTGCTTTCCTCCCCCTC 0: 1
1: 0
2: 6
3: 69
4: 587
Right 1053480968 9:38415906-38415928 ATTCAGCTGTACCCATCTGAGGG No data
1053480957_1053480972 30 Left 1053480957 9:38415865-38415887 CCCAGGCTGCTTTCCTCCCCCTC 0: 1
1: 0
2: 6
3: 69
4: 587
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480957_1053480970 29 Left 1053480957 9:38415865-38415887 CCCAGGCTGCTTTCCTCCCCCTC 0: 1
1: 0
2: 6
3: 69
4: 587
Right 1053480970 9:38415917-38415939 CCCATCTGAGGGCCCTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480957 Original CRISPR GAGGGGGAGGAAAGCAGCCT GGG (reversed) Intronic
900205508 1:1430530-1430552 GAGGGGAAGGAAGGCGGCCGCGG - Intergenic
900816744 1:4853196-4853218 GAGGAGGAGGAAGGCAAGCTTGG - Intergenic
901213326 1:7538972-7538994 AAAGGGAAGGAAAGCAGGCTGGG - Intronic
901490889 1:9595693-9595715 GAAGGAGAGGAACGCAGACTAGG - Intronic
901640897 1:10692503-10692525 GAGGGGCAGGGTGGCAGCCTTGG + Intronic
901807128 1:11745610-11745632 GAGGAGGAAGAAAGCAGGCCAGG - Intronic
901831598 1:11895710-11895732 CAGGAGGTGGAGAGCAGCCTGGG + Intergenic
902649111 1:17825114-17825136 CAGGGGGAGAAAACCAGCCCAGG + Intronic
902801057 1:18830592-18830614 GAGGGGGAGGGAAGAGGCCTCGG - Intergenic
902835335 1:19043510-19043532 GCGGAGGATGAAAGCAACCTGGG + Intergenic
903187993 1:21640090-21640112 GAGAAGGAGGAAAGAAGCCCTGG - Intronic
903858952 1:26353877-26353899 GAGGGAGAGGAAGGCAGGGTTGG + Intronic
904337809 1:29809591-29809613 GAGGGAGAGGAAAAGAGCCTTGG - Intergenic
904393799 1:30204565-30204587 GAGGGGGTGGTGAGCAGCCCTGG - Intergenic
904524170 1:31120140-31120162 GATTGGGAGCAAAGCAGCCCTGG + Intergenic
905867694 1:41385152-41385174 GAGGGGGAGGATTGCAGAGTTGG + Intergenic
905995892 1:42380570-42380592 GAGGCGGAGGAGGGCAGCCCCGG - Intergenic
908622451 1:65999365-65999387 GAGGAGGTTGGAAGCAGCCTGGG - Intronic
909007180 1:70290764-70290786 CAGGAGGTGGAAACCAGCCTGGG - Intronic
909492251 1:76238641-76238663 GAGGGGGAAGGAACCAGCTTTGG + Intronic
910313582 1:85856663-85856685 GAGTAGGAGGAAAGCAGTTTAGG - Intronic
911157956 1:94655161-94655183 GAGCTGGAGGGACGCAGCCTGGG - Intergenic
912519045 1:110232944-110232966 GAGGGTGAGGACTTCAGCCTGGG - Exonic
912876994 1:113370435-113370457 GAGGGGGAAGAATGGAGCCTGGG - Intergenic
912890754 1:113527158-113527180 GAGGGGGAGAAAAAGAGCCAAGG + Intronic
913007820 1:114652028-114652050 CAAGGTGAGGAAAGCATCCTAGG + Intronic
913267704 1:117060757-117060779 GAGAGGGGGGTAACCAGCCTCGG - Intronic
914855366 1:151346674-151346696 GAGGGGGAGGAGGGCAGTATGGG - Intronic
915897789 1:159824996-159825018 GAGTGGGAGGACAGCAGGCAGGG - Intergenic
915945907 1:160151760-160151782 AAGAGGGAGGAGAGAAGCCTAGG - Exonic
916040184 1:160954896-160954918 GAGGGAGGGGCTAGCAGCCTAGG - Intergenic
917841875 1:178986826-178986848 GATGGGGAGAAAAGCAGCTCAGG - Intergenic
918321597 1:183370141-183370163 AAGGGGGAGAAAAAGAGCCTGGG + Intronic
919978726 1:202629290-202629312 CAGGGGCAGGAAAGAAGCCAGGG - Intronic
920117082 1:203628756-203628778 CAGGCCCAGGAAAGCAGCCTGGG + Intronic
920818560 1:209358422-209358444 GAGGGAGAGGCCACCAGCCTAGG - Intergenic
923025225 1:230198388-230198410 CAGGGGCAGGACAGCAGCCCAGG + Intronic
923025234 1:230198427-230198449 CAGGGGCAGGACAGCAGCCCAGG + Intronic
923025243 1:230198466-230198488 CAGGGGCAGGACAGCAGCCCAGG + Intronic
923025252 1:230198505-230198527 CAGGGGCAGGACAGCAGCCCAGG + Intronic
923645758 1:235818973-235818995 GAGGGGGAGAACAGCAATCTTGG - Intronic
923902011 1:238336296-238336318 GAGGTGGGGGATTGCAGCCTGGG + Intergenic
924081802 1:240406234-240406256 GAAGCGAAGGGAAGCAGCCTCGG + Intronic
924152020 1:241139260-241139282 GATGGGGAGGAAAGGAGAGTGGG - Intronic
924360544 1:243236793-243236815 CAATGGGAGGAAAGCAGTCTGGG + Intronic
924363966 1:243269711-243269733 GAGGGGGACGAAAGGAGCAGTGG - Intronic
924705414 1:246497651-246497673 GAGTGGGAGGACAGCCTCCTAGG + Intronic
1062856287 10:781054-781076 GGTGGGCAGGAAAGCAGCCCAGG - Intergenic
1063130210 10:3171809-3171831 GAGGGGGATCAAACCAGCCTGGG + Intronic
1064146503 10:12830300-12830322 GGAAGGGAGGGAAGCAGCCTTGG + Exonic
1065320489 10:24504412-24504434 GATGGGGAGGAAAGCTGAATGGG - Intronic
1066338290 10:34502916-34502938 GAGAGGGAGGAAAGCCAGCTGGG - Intronic
1067454725 10:46411120-46411142 GAGAATAAGGAAAGCAGCCTAGG + Intergenic
1067632479 10:47973519-47973541 GAGAATAAGGAAAGCAGCCTAGG - Intergenic
1068448432 10:57153963-57153985 GAGGAGGAGGAAAACATCTTTGG - Intergenic
1069565572 10:69461378-69461400 GGGTGGAAGGAAAACAGCCTTGG + Intronic
1069855870 10:71440718-71440740 GGTGGGGAGCAAAGCAGCCCTGG + Intronic
1070228268 10:74535250-74535272 GAGGTGTTGGAAACCAGCCTGGG + Intronic
1072548445 10:96458168-96458190 GACGGGGAGGAGAGCTGCTTAGG + Intronic
1072661537 10:97366556-97366578 GAGGAGGAGGAAAGAAGCCGAGG - Exonic
1073094951 10:100973628-100973650 GAAGGGGAGGAAAGGAGCTGGGG - Intronic
1073542356 10:104324337-104324359 GAGGGGCAGGTGAGCAGACTGGG + Intronic
1074094987 10:110304361-110304383 GGCGGGGAGGAGAGCAGCCTGGG - Intronic
1074125310 10:110524570-110524592 CGGGGGCAGGAAAGCAGACTGGG - Intergenic
1075413542 10:122246616-122246638 GAGGGTGAGAAAAGCTGCCCGGG + Intronic
1075471957 10:122697648-122697670 GATGGGGTGGCAAGGAGCCTGGG + Intergenic
1075914784 10:126157863-126157885 GAGGGGAAGGAGAGCAGGCAAGG + Intronic
1076202997 10:128572995-128573017 TACGGGGAGGTAAGCAGCCCTGG - Intergenic
1076606742 10:131694430-131694452 GAACGGGAGGAAAGCAGTCCTGG - Intergenic
1076992973 11:285111-285133 GCGGTGGGGGAAAGCAGCCAGGG - Intronic
1077443126 11:2577918-2577940 AAGGTGGAGGAAAGGGGCCTAGG - Intronic
1077885460 11:6384226-6384248 GAAAGGGAAGAAAGCAGACTTGG - Intergenic
1078348675 11:10574300-10574322 AAGGTGGTGGAGAGCAGCCTGGG - Exonic
1078354801 11:10625639-10625661 TTGGAGGAGGAAAGCAGCCCAGG + Intronic
1078456372 11:11478855-11478877 GCGGGGGAGGGGAGAAGCCTAGG + Intronic
1079253980 11:18810534-18810556 GAGGGTGAGGGAAGCAGAATAGG + Intergenic
1079961944 11:26935327-26935349 GAAGGGAAGGAAAGCAGAATTGG - Intergenic
1080062980 11:27977158-27977180 GAGGGGAAGGAATGCCACCTAGG + Intergenic
1081144275 11:39542284-39542306 GGTTGGGAGGAAAGCAGTCTAGG + Intergenic
1081406998 11:42709563-42709585 AAGGGAGAGGAATGCTGCCTTGG - Intergenic
1082761548 11:57131569-57131591 CATGTGGAGGAAAGCAGGCTGGG - Intergenic
1083570487 11:63758976-63758998 GAGAGGGAGGAAAGCACATTCGG - Exonic
1083607727 11:63988768-63988790 GAGCGGGTGGGAAGCACCCTGGG + Intronic
1084129411 11:67121255-67121277 GAGGAAGAGGAAGGCAGCCCTGG + Exonic
1084730121 11:71067412-71067434 CAGAGGGAGGGGAGCAGCCTGGG - Intronic
1084964692 11:72738516-72738538 GGAGGGGAGGAAGGCAGGCTAGG + Intronic
1085401752 11:76239764-76239786 TTGGGGGAGGAAGCCAGCCTGGG - Intergenic
1085410527 11:76287975-76287997 GAGGGGGAGGAGAACTGGCTGGG - Intergenic
1085643843 11:78209938-78209960 GAGGAGGAGGAAAGCACCAGAGG + Exonic
1086193502 11:84109001-84109023 GAGGATGAGGAAAGCAGTTTGGG + Intronic
1086392800 11:86382601-86382623 GAGGGGGTGGCAAGGAGTCTGGG + Intronic
1086549587 11:88040476-88040498 GAGGGCCAGGAAGGCAGCCCAGG + Intergenic
1088154241 11:106784162-106784184 AAAGGGGAGGAAAGCAGCGGAGG - Intronic
1089211688 11:116808272-116808294 GTTGGGGTGGGAAGCAGCCTGGG + Intergenic
1089228697 11:116950012-116950034 GCGGGGGAGGACAGCAGCCTGGG + Intronic
1089367219 11:117928288-117928310 GAGGGCAAGGGAGGCAGCCTGGG + Intronic
1089970905 11:122692537-122692559 GAGAGGAAGGAATGCACCCTTGG + Intronic
1089980222 11:122766071-122766093 GAGGGGCAGGATAGCAGCTGTGG + Intronic
1090263932 11:125342409-125342431 GGGGAGGAGGAAAGCAGGCATGG - Intronic
1091620506 12:2084529-2084551 GAGGGAGAGGAATGAAGCCACGG - Intronic
1091829031 12:3536223-3536245 GAGTGGGTGGGAAGCAGCCGTGG - Intronic
1092432485 12:8420534-8420556 GAGAGGTAGGACACCAGCCTCGG + Intergenic
1092629543 12:10363301-10363323 GAGGGGGAAAACAGCAGCATAGG + Intergenic
1094107952 12:26833261-26833283 GAGGAGGAGGAGAGGAGCCCTGG + Intergenic
1094526240 12:31233201-31233223 GGGGGTGAGGAAAACAGCCAGGG - Intergenic
1095704189 12:45219995-45220017 GAGGGGGCGAAAAGCAGCCAAGG - Intronic
1096230554 12:49894481-49894503 GAGGGGGAGGCTGGCAGCCCAGG + Intronic
1096321809 12:50620825-50620847 GAGGGGGAAGAATGCTGGCTGGG - Intronic
1096585859 12:52619127-52619149 GAGGAGCAGGAGAGCTGCCTGGG - Intergenic
1096770987 12:53936010-53936032 GAGGGGGAAGAAACCACCCCAGG + Intergenic
1096975976 12:55699450-55699472 GAGGAGGAGGAAACCAGGCCTGG - Intronic
1097193725 12:57232627-57232649 GTGTGGGAGGAGGGCAGCCTTGG + Intronic
1097585908 12:61516030-61516052 AAGGGGCAGGAAAGGAGGCTGGG - Intergenic
1097970058 12:65623931-65623953 GTGGGGGAGGAAAGCTCTCTAGG - Intergenic
1100384093 12:94090001-94090023 GTCTGGGAGGGAAGCAGCCTGGG - Intergenic
1101862460 12:108494169-108494191 GAGGGGCTGGAAAGCAGGCAGGG - Intergenic
1103587006 12:121963493-121963515 GACGGGGAGGACACCAGCCGGGG + Intronic
1103637560 12:122320392-122320414 CAGGAGGTGGAAAGTAGCCTGGG + Intronic
1103914433 12:124369205-124369227 GAGGGGAAGGCAGGCAGGCTCGG + Intronic
1104745652 12:131208615-131208637 GAGGTGGAGAAAAGCCCCCTGGG + Intergenic
1104778925 12:131407350-131407372 GAGGGGCAGGAACGGAGGCTGGG - Intergenic
1104788694 12:131468493-131468515 GAGGTGGAGAAAAGCCCCCTGGG - Intergenic
1104927312 12:132320654-132320676 GAGGTGGAGGGAAGCTCCCTCGG + Intronic
1105013497 12:132771837-132771859 GAGGAGGAGGAGAGCAGACCAGG - Exonic
1106243043 13:27925320-27925342 GAGGGGGAGGAAAGGAGAGCAGG - Exonic
1106243056 13:27925369-27925391 GAGGGGGAGGAAAGGAGAGCAGG - Exonic
1106590854 13:31097333-31097355 GCAGGGGAGGATAGGAGCCTGGG - Intergenic
1106753033 13:32794442-32794464 GAGGGGCAGCAAGGAAGCCTGGG - Intergenic
1107168962 13:37317156-37317178 CAGGGGCAGGATAGCAGCGTAGG + Intergenic
1107793235 13:44023746-44023768 GAGGGGAAAGAAAGCAGACTTGG + Intergenic
1107933750 13:45327639-45327661 GAGGGAGAGGACAACACCCTTGG + Intergenic
1108303688 13:49108383-49108405 GTGGTGAAGGGAAGCAGCCTTGG + Intronic
1108707291 13:53001140-53001162 AAGGGGGAGAAAAGCAGAGTTGG - Intergenic
1109229804 13:59743053-59743075 GAGTGGGATGAAATAAGCCTAGG + Intronic
1112693905 13:101926389-101926411 GCAGGGGAGTAAAGCAGCCTAGG - Intronic
1112863741 13:103868201-103868223 GAAGGGGAGTAAAGAAGCATTGG + Intergenic
1112922822 13:104636444-104636466 GAGGGTGAGGGAAGCAGGATTGG + Intergenic
1113678634 13:112226332-112226354 GAGAGGGAAGAAAGCGCCCTTGG + Intergenic
1113927961 13:113951656-113951678 CAGGGGGATGAATGCAGCCTTGG - Intergenic
1114532036 14:23402437-23402459 GAGGGGCAGGCAGGCAGCCCTGG - Intronic
1114663697 14:24366776-24366798 GGGAGGGAGGGAAGCCGCCTCGG + Intronic
1115474447 14:33800207-33800229 TTGGGGGAGGACAGCAGCCGCGG - Exonic
1117992602 14:61449326-61449348 GAGGGGGAGGAAAGGAGGGAGGG - Intronic
1118906491 14:70027399-70027421 GAGGGGGAGCAGACCAGCCTGGG + Intronic
1119045999 14:71319880-71319902 GAGGAGGAGGGAGGCAGCATGGG + Intergenic
1119424086 14:74524641-74524663 GAGGGAGAGGAATGCAGGCTTGG + Intronic
1119988561 14:79168635-79168657 AACAGGGAGGAAACCAGCCTAGG - Intronic
1120655957 14:87190124-87190146 GAGTGGGAGGACGGCAGCCTTGG - Intergenic
1121011117 14:90520850-90520872 GAGGGTGGGGCAAGGAGCCTGGG - Intergenic
1121036057 14:90704569-90704591 CAGGGACAGGAGAGCAGCCTGGG + Intronic
1121256259 14:92532510-92532532 GAAGGGGAGACAAGGAGCCTGGG - Intronic
1121600384 14:95199002-95199024 GAGGGGGAAGATGGCAGCCGTGG + Intronic
1122280222 14:100617805-100617827 GCGTGGGAGGGAGGCAGCCTGGG + Intergenic
1122881593 14:104692818-104692840 GCGAAAGAGGAAAGCAGCCTTGG - Intronic
1123029864 14:105446535-105446557 GAGGGGCAGGAAGTCAGCCCAGG + Intronic
1123060666 14:105592761-105592783 GAGGAGGAGGGAGGTAGCCTGGG + Intergenic
1123085141 14:105713732-105713754 GAGGAGGAGGGAGGTAGCCTGGG + Intergenic
1202924106 14_KI270724v1_random:8356-8378 GAGGGGGAGGAAGTCAGCAGTGG + Intergenic
1124002635 15:25771669-25771691 GAGGGGCAGGTAGGCAGCCAGGG - Intronic
1124494338 15:30177209-30177231 CAGGGGCAGGAAAGAAGCCAGGG - Intergenic
1124749232 15:32361436-32361458 CAGGGGCAGGAAAGAAGCCAGGG + Intergenic
1124861896 15:33449889-33449911 GAGGGGGACAAAGGCAGCCGAGG + Intronic
1125394376 15:39231072-39231094 GAGAGGGAGGAAACCATGCTGGG + Intergenic
1125601544 15:40918345-40918367 GAGGGGGAGGCAAGGAGGCCAGG + Intergenic
1126901699 15:53321135-53321157 ATGGGGGAGGAAAGGAGCTTAGG + Intergenic
1127329526 15:57924895-57924917 CAGAGGGAGGAAACCAGTCTGGG + Intergenic
1127613138 15:60656821-60656843 AATGGGGAGGAAAGAGGCCTTGG - Intronic
1127707595 15:61562466-61562488 GGGAGGGAGGAAAGGGGCCTGGG + Intergenic
1127792013 15:62406399-62406421 GAGGTAGAGGAAAACAGCTTTGG + Intronic
1128096889 15:64963642-64963664 GAGGTGCAGAAAGGCAGCCTTGG - Exonic
1128331691 15:66760342-66760364 GAAGGGAAGGAAGGCAGCATGGG + Intronic
1128576967 15:68782942-68782964 GAGGAGGAGGTAAGGAGGCTGGG - Exonic
1128751994 15:70156414-70156436 GTAGGGAAGGAAAGGAGCCTGGG - Intergenic
1129703569 15:77781950-77781972 AAGGCAGAGGGAAGCAGCCTGGG + Intronic
1130046911 15:80452825-80452847 GCCGAGGAGGGAAGCAGCCTCGG - Intronic
1130287801 15:82570314-82570336 GAAGGGAAGGACAGCAGACTTGG + Intronic
1131176669 15:90213565-90213587 GAAGGGGTGGAAACCTGCCTCGG - Intronic
1131476541 15:92744880-92744902 GAGGAGTTGGAAACCAGCCTGGG - Intronic
1132376291 15:101330283-101330305 GAGGGGGACGAGGGAAGCCTAGG - Intronic
1132929148 16:2449806-2449828 GCTGGGGAGGAAAGCAGGCCAGG - Exonic
1133126200 16:3647793-3647815 CAGGAGTTGGAAAGCAGCCTGGG + Intronic
1133341721 16:5040818-5040840 GACAGGGAGGAAAGGAGGCTTGG - Intronic
1133531991 16:6663806-6663828 GATGGGGTGGAGAGCATCCTGGG + Intronic
1133586022 16:7196350-7196372 GAGGGGGAGTGAAGCAGGGTGGG - Intronic
1135025571 16:18996707-18996729 AAGGGGGTGGAGAGCAGCCCTGG + Intronic
1135470852 16:22729219-22729241 GGGAGGGAGGAAAGCAGGCCTGG + Intergenic
1135971389 16:27074408-27074430 CAGGGGGAGGCAAGCAGGATGGG + Intergenic
1136572821 16:31106789-31106811 GAGGGGGAAAAAATCACCCTGGG + Intronic
1137348516 16:47688099-47688121 GTGGGGGAGAAAGGCAGCATGGG + Intronic
1137433080 16:48434075-48434097 GACAGGGAGGAAAGAAACCTGGG - Intronic
1137676555 16:50306500-50306522 GCAGGGAAGGAAAGCAGGCTCGG - Intronic
1137964775 16:52919986-52920008 GTGGGGGAGGGAAGCATGCTGGG - Intergenic
1138143666 16:54589390-54589412 GAGGGGGAAGAGAGCAGTGTGGG - Intergenic
1138275057 16:55728329-55728351 GAAGGGGATGAAGGCAGCTTGGG + Intergenic
1138399036 16:56730593-56730615 GAGGGGTAGGCAAGCAGGCAGGG - Intronic
1138563440 16:57815821-57815843 GAGTGGCAGGAAAGGAGTCTGGG - Intronic
1138656176 16:58492859-58492881 GAGGGGGAGGACAAGGGCCTGGG - Intronic
1139008322 16:62601121-62601143 GAAGGGGAAGAAAGCAGGATTGG - Intergenic
1139232164 16:65294295-65294317 GAGGAGGAGGAAAGCTTCCATGG - Intergenic
1139741805 16:69041680-69041702 AAGGGGGAGAAATGCAGCCGAGG - Intronic
1139923166 16:70472156-70472178 GAGAGGGAGGTAACCCGCCTTGG + Intronic
1140829779 16:78740450-78740472 GAAGGGAGGGAAGGCAGCCTTGG + Intronic
1141263589 16:82475669-82475691 GTTGGGAAGGAAACCAGCCTGGG - Intergenic
1142597715 17:1037641-1037663 GAGGAGCAGGCAAGCAGCCCAGG - Intronic
1142645633 17:1312402-1312424 CAGGGAGAAGAAGGCAGCCTGGG + Intergenic
1142847912 17:2691014-2691036 CAGGGGGAGGAAAGCGGAGTTGG + Intronic
1142866093 17:2792466-2792488 GAAGGAGAGGAAGGCAGCGTGGG + Intronic
1143562581 17:7704593-7704615 GAGTGGGAGGTGCGCAGCCTGGG + Intergenic
1143724881 17:8837961-8837983 GATGGGGTGGAAGGCAGCCAGGG + Intronic
1144783715 17:17820387-17820409 GAGGTGGAGACAAGCTGCCTGGG + Exonic
1146031214 17:29367551-29367573 GAGGAGTTGGAAACCAGCCTGGG - Intergenic
1146085919 17:29829512-29829534 GAGAGGGAAGAAGGGAGCCTGGG + Intronic
1146624500 17:34425139-34425161 GAGGGGAAGGTGAGCAGGCTAGG - Intergenic
1146653399 17:34621084-34621106 CAGGGGGAGGAAGACAGGCTGGG - Intronic
1146684028 17:34828313-34828335 GAAGTGGAGGCAAGCAGCCTGGG - Intergenic
1146762026 17:35487385-35487407 GAAGGGAGAGAAAGCAGCCTCGG + Intronic
1147215659 17:38897689-38897711 GGAGGGGAGGAAAGCAGCGGGGG - Intronic
1148177209 17:45577231-45577253 GAGCGGGAGGAAAGGAGTCAAGG - Intergenic
1148456361 17:47813536-47813558 CAGGGAGAAGGAAGCAGCCTTGG + Intronic
1148459827 17:47833005-47833027 CAGGGGTAGGACAGCAGCATTGG + Intronic
1148767773 17:50049263-50049285 GAGGGGGCTGAAGGCAGACTGGG + Intergenic
1148855091 17:50574604-50574626 GAGGGGGAAGGAAGCAGACAGGG + Intronic
1148868013 17:50639201-50639223 GAGATGGAGGAAAGGAGCCCCGG - Intronic
1149544248 17:57491419-57491441 GAGGTGCTGGAAAGCAGCCCAGG + Intronic
1149661871 17:58338309-58338331 GAGGGGGAGGTGAGAAGCCTGGG + Intergenic
1149900105 17:60468265-60468287 GAGGGGAAGCAAAGCAACCAAGG + Intronic
1151102025 17:71566899-71566921 AAGGGAGAGGAAAGCAGGCGTGG + Intergenic
1151646596 17:75436640-75436662 GAGGCTGAGGAAAGGATCCTGGG + Intergenic
1151936012 17:77261720-77261742 GAGAGGGGAGAAAGCAGCCATGG - Intergenic
1152076359 17:78162324-78162346 GTGGGGTTTGAAAGCAGCCTTGG - Intronic
1152254333 17:79228671-79228693 GACGTGGAGCAAAGCAGCTTTGG + Intronic
1152635692 17:81429736-81429758 GAGGGGGTGGCAAGCTGGCTTGG - Intronic
1152722381 17:81929306-81929328 GAGGGGCAGCAAAGGAGCCTGGG - Intergenic
1153666311 18:7370181-7370203 GAGAGGGAGGAGAGCAGCTCAGG - Intergenic
1153904663 18:9650491-9650513 GAGGAGGAGGAAGGGAGACTGGG + Intergenic
1154441171 18:14391847-14391869 GAGACGGGGGAAATCAGCCTGGG - Intergenic
1156470320 18:37373715-37373737 GAGGGGCTGGAAAGCAGCCTGGG + Intronic
1157187396 18:45552360-45552382 GTGGGGGAGAGAAGGAGCCTGGG - Intronic
1157419215 18:47531402-47531424 GAGAGGCAGGCTAGCAGCCTGGG - Intergenic
1157500366 18:48186202-48186224 GAGGGAGAGGGAGGCAGCGTGGG - Intronic
1157524713 18:48372081-48372103 GTGAGGGAGGAGAGCAGCCCTGG - Intronic
1157557506 18:48622322-48622344 GAGGTGGAGGAATGCAGTCATGG + Intronic
1158192778 18:54849379-54849401 GAGTGGGAGGAAAGAAGATTTGG - Intronic
1158225462 18:55196720-55196742 GAAGGGGAGAAAAGCAGTTTGGG + Intergenic
1159035925 18:63277001-63277023 GAGATGGAGGAAAGCAGCCCTGG - Intronic
1160074383 18:75658415-75658437 GAGGGGGAGGAAAGGAGAGCAGG + Intergenic
1160679640 19:406842-406864 GAGGAGGAGGAGAGGGGCCTCGG - Exonic
1160848404 19:1177410-1177432 AAGGGTGAGGAAGCCAGCCTGGG + Intergenic
1161025084 19:2033027-2033049 GAGGGGGAGGCTTGCAGGCTGGG + Intronic
1161106054 19:2444650-2444672 GAGAGAGAGGATGGCAGCCTGGG + Intronic
1161465724 19:4429217-4429239 GAGAGGGAGGACAGCTGCCCAGG - Intronic
1161521347 19:4725398-4725420 CAGGAGCTGGAAAGCAGCCTGGG - Intergenic
1161962959 19:7532986-7533008 GAGTGAGAGGAAGGAAGCCTTGG + Intronic
1162722496 19:12670638-12670660 GAGGGGGAGGGCAGCACCCTGGG - Exonic
1162925864 19:13930281-13930303 GAGAGTGAGGTAAGCAGCTTAGG + Exonic
1162966405 19:14158263-14158285 GAGGGGCAGGTACACAGCCTGGG + Intronic
1163398152 19:17075986-17076008 GAGGGGGCGGGAACGAGCCTGGG + Intronic
1163754092 19:19096268-19096290 GAGGAGGAGGCAGGGAGCCTGGG - Intronic
1165714266 19:38034445-38034467 GACAGGGAGGCATGCAGCCTGGG + Intronic
1165795683 19:38517717-38517739 GAGGGGTGGGTCAGCAGCCTGGG + Intronic
1165802202 19:38559578-38559600 GAGGGGTAGGCAAGCAGACGAGG + Intronic
1166311600 19:41966333-41966355 GAGAGGGAGGGAAGCAGACGTGG - Intergenic
1166330510 19:42075750-42075772 GAGAGGGAGGAAAAGAGCCTGGG - Intronic
1166584580 19:43934548-43934570 CAGGGGAAGGAAAGGAGGCTGGG + Exonic
1166879651 19:45920056-45920078 TGGGGGGTGGAAAGCAGCCATGG - Intergenic
1167882793 19:52475940-52475962 GAAGGGCATGAAAGGAGCCTTGG - Intronic
1168261353 19:55196823-55196845 GAGGGGGTGGAAAGCCACCTTGG - Intronic
1168294037 19:55370165-55370187 GCCGGGGAGGAGAGCAGCTTCGG - Intronic
925091876 2:1162953-1162975 GCAGGGGAGGAAAGACGCCTTGG + Intronic
925126473 2:1460956-1460978 GAGCTGGTGAAAAGCAGCCTTGG + Intronic
925230233 2:2226497-2226519 GAGAAGGAGAAAAGCAGCCTGGG - Intronic
925468750 2:4135981-4136003 GAACAGGAGGAACGCAGCCTGGG - Intergenic
927101251 2:19789316-19789338 GTGGGGTAGGAAGGCAGGCTGGG + Intergenic
928188357 2:29136708-29136730 GAGGGTGAGGAAAGCATCTTAGG + Intronic
929286467 2:40140565-40140587 GAGGGGGTGGACAGCAAGCTGGG + Intronic
929450082 2:42030951-42030973 GATGGGGAGGGAGGCAGCCCAGG - Intergenic
929553604 2:42909761-42909783 GAAGGTGAGGAAAGAAGTCTGGG + Intergenic
929759943 2:44798458-44798480 GGGCTGGAGGAAAGCAGGCTAGG - Intergenic
929778883 2:44944764-44944786 GAGAGGGAGGAGGGCGGCCTTGG - Exonic
930847694 2:55923546-55923568 GAGGTGGAGGTGTGCAGCCTCGG - Intronic
931256843 2:60581634-60581656 GAGGTGGAGGAAAGCTTCCTGGG + Intergenic
932456206 2:71851558-71851580 GAGGAGGAGGAAAGGAGCAATGG + Intergenic
932466025 2:71924941-71924963 GAGGGTGAGGAGTGCAGCCTAGG + Intergenic
932599936 2:73116724-73116746 GAGGGGAACGAAACCAGCCAGGG + Intronic
932947745 2:76257006-76257028 GAGGGGCAGGAAAAGAGCCAAGG + Intergenic
933698774 2:85239361-85239383 GAGGGGGAGGGATGCTGCCTGGG - Intronic
934514056 2:94973691-94973713 AAGAGGGAGGAAAGGAGGCTGGG + Intergenic
935155383 2:100479658-100479680 GAGAGGGATGGAAGCAGGCTGGG - Intronic
935456069 2:103268984-103269006 GTGAGGAAAGAAAGCAGCCTGGG + Intergenic
935996510 2:108779838-108779860 GGGCTGGTGGAAAGCAGCCTTGG - Intronic
936109531 2:109653578-109653600 GAGGGGAGGGCCAGCAGCCTCGG - Intergenic
936658327 2:114514021-114514043 GAAGGGGAGGAAAGATGCCTTGG - Intronic
937027470 2:118711364-118711386 GAGGGAGACAAAAGCAGCTTGGG - Intergenic
937985407 2:127636083-127636105 GGAGGGGAGGAATGCAGCATGGG - Intronic
938095456 2:128458444-128458466 GAGGGGGATGATATCAACCTAGG - Intergenic
938200257 2:129366969-129366991 GAGGGGAAGGAAAGGAGGCAGGG - Intergenic
940012965 2:149073858-149073880 GAGGGAGAGGACAGCAACCTCGG + Intronic
940343288 2:152603203-152603225 GATTGGCAGCAAAGCAGCCTTGG + Intronic
940773029 2:157858825-157858847 CAGGAGTAGGAAATCAGCCTGGG - Intronic
941436807 2:165482708-165482730 GAGGTGGAAGAAACCAGCCTGGG - Intronic
942051869 2:172147564-172147586 GAGGGGGAGAAGAGAAGCCCTGG + Intergenic
942231789 2:173867048-173867070 GAGGGGCTGGAAAGGAGCCAGGG - Intergenic
944197649 2:197072125-197072147 TAGGGGGAGGAAAGGAGGGTGGG + Intronic
944225336 2:197343848-197343870 GAGTGGGAGGGAAGGAGGCTTGG + Intergenic
945087358 2:206145723-206145745 GAGGGGGTGGAGAGGAGCATAGG - Intronic
945307693 2:208274438-208274460 GAGGGGAAGGGATGCAGCATTGG + Intronic
946135379 2:217642381-217642403 GAAGGGGAGGAAAGGAGACTGGG + Intronic
946652276 2:221906279-221906301 GAGGGGGAAGAAAGGAGGATTGG + Intergenic
947734658 2:232448342-232448364 GAGGGGGAGGAGTGCAGGCTGGG - Intergenic
948239273 2:236416129-236416151 GAGAGGGAGGGAAGCAGCCCTGG + Intronic
948721899 2:239905851-239905873 GGAGGGGAGGGGAGCAGCCTGGG + Intronic
948983048 2:241504675-241504697 GAGGCTGAGGAGACCAGCCTGGG - Intronic
948995404 2:241575877-241575899 CAGGGGAACGAAAGCAGCATGGG - Intergenic
948995451 2:241576078-241576100 GAGGGGGAGGAGAGCTGGCAGGG - Intergenic
1168813272 20:720064-720086 GAGCAGGAGGAAAGAAGGCTGGG + Intergenic
1169271480 20:4202708-4202730 AAGGCTCAGGAAAGCAGCCTGGG - Intergenic
1169431163 20:5537685-5537707 GAGAGGGAGGAAAGAAGCAAGGG + Intergenic
1169684121 20:8251374-8251396 GAGAGTAAGGAAAGTAGCCTTGG + Intronic
1169730269 20:8778390-8778412 GAGGGTGTGGAAAGCAGCTCAGG + Intronic
1170104206 20:12736242-12736264 GAGAAGGAGTAAAACAGCCTGGG + Intergenic
1171820802 20:29836096-29836118 GAGGGGGAGCAACAGAGCCTTGG - Intergenic
1172008803 20:31834471-31834493 GAGGGGGAGGGGAGAAGCCAAGG + Exonic
1173049665 20:39546976-39546998 ATGGGCCAGGAAAGCAGCCTGGG + Intergenic
1173080538 20:39862938-39862960 GAAGGGGAGAAAAGTGGCCTTGG - Intergenic
1173678873 20:44862001-44862023 GAGGGGGAGGAAAGGAGGGGGGG + Intergenic
1173753053 20:45491850-45491872 GAGGGGGAAGAGACCAGTCTGGG - Intergenic
1173807326 20:45934572-45934594 GAGGGGGCCGAAAGCAAGCTGGG + Intergenic
1175076901 20:56382927-56382949 GAGGGGGAGGGGTGCAGCATTGG + Intronic
1175264593 20:57695096-57695118 GTCTGGGAGGAAGGCAGCCTCGG + Intronic
1175300338 20:57938358-57938380 GTGGGAGAGGAAACCAGCCAGGG + Intergenic
1175433733 20:58927759-58927781 CAGGGAGTGGAAGGCAGCCTGGG - Intergenic
1175592421 20:60203725-60203747 GAGGGGAAGCAAGGCAGCCTCGG + Intergenic
1175820436 20:61906264-61906286 TTGGGGCAGGAAAGCAGCCACGG + Intronic
1175851607 20:62096994-62097016 GAGGGGGAGGACAGGAGCCAGGG + Intergenic
1176047672 20:63101167-63101189 GAGAGGGAGGGAGGCAGCCTGGG + Intergenic
1176366349 21:6035223-6035245 GAGGGGGTGGGCAGCAGCCAGGG - Intergenic
1176868878 21:14071735-14071757 GAGGGCGAGACAAGCACCCTGGG - Intergenic
1178028984 21:28503512-28503534 GCTGGGGAAGAAAACAGCCTAGG + Intergenic
1178144328 21:29721073-29721095 GAGGGGGATGTAAGCAACTTAGG - Intronic
1178174593 21:30081911-30081933 GCCGGGCAGGAAAGCTGCCTCGG + Intergenic
1178599100 21:33980652-33980674 GGGGAAGAGGCAAGCAGCCTTGG - Intergenic
1178905400 21:36632197-36632219 GTGGGGGAAGAAGGCAGCATTGG - Intergenic
1179243567 21:39611770-39611792 GATGGAGAGGAACGCAGCCGTGG - Intronic
1179757168 21:43503322-43503344 GAGGGGGTGGGCAGCAGCCAGGG + Intergenic
1180092143 21:45538649-45538671 GAGGGGGCTGAGAGCAGCCAGGG + Intronic
1180324838 22:11361039-11361061 GAGGGGGAGCAACAGAGCCTTGG - Intergenic
1180835578 22:18927983-18928005 GAAGAGGAAGAAAGCACCCTGGG + Intronic
1181291176 22:21794708-21794730 GAGGGGGTGGCTACCAGCCTGGG + Intronic
1181851053 22:25750233-25750255 GAGAGGGAGGAAGGCAACCATGG + Intronic
1181978746 22:26751493-26751515 GAGGGGGAGGAAGGCAGCTCAGG + Intergenic
1182707179 22:32291244-32291266 GAGGCGGAGGGTGGCAGCCTGGG - Intergenic
1183178853 22:36245085-36245107 GATGGGGAGGAAATAGGCCTGGG - Intergenic
1183897178 22:40978692-40978714 GAGGATGAGGACACCAGCCTTGG - Intergenic
1184066507 22:42124673-42124695 GGAGGGGAGGGAAGCAGCCCAGG + Intergenic
1184068975 22:42136825-42136847 GGAGGGGAGGGAAGCAGCCCAGG + Intergenic
1184150270 22:42633877-42633899 GAGGTTGCAGAAAGCAGCCTGGG + Intronic
1184395527 22:44234408-44234430 GAGGCGGAGGGTGGCAGCCTGGG - Intergenic
1184411050 22:44326705-44326727 GAGGGGAAGGAGAGCAGGCTGGG + Intergenic
1184415697 22:44350675-44350697 GCGTGGGAGGGCAGCAGCCTGGG + Intergenic
1184549233 22:45195671-45195693 GAGGGGGAGGAGGGCATCCCAGG + Intronic
1184991155 22:48170851-48170873 GAGAGGGATGATAGAAGCCTGGG - Intergenic
1185037479 22:48487286-48487308 GAGGGAGAGGAGAGCACTCTTGG - Intergenic
1185342838 22:50299319-50299341 GGGGGCGGGGGAAGCAGCCTCGG + Intronic
1203285666 22_KI270734v1_random:153282-153304 GAAGAGGAAGAAAGCACCCTGGG + Intergenic
949526167 3:4906511-4906533 GAAGGGGTGGAAAGCAAGCTTGG - Intergenic
950430298 3:12947106-12947128 AGCCGGGAGGAAAGCAGCCTCGG + Intronic
951618377 3:24573761-24573783 GAGGAGGAGGAAAGTAGGATTGG - Intergenic
952198673 3:31102517-31102539 GAGAGTGAGGAAAGCAGAATTGG + Intergenic
953391367 3:42535827-42535849 GAGAGGGAGGGATGCTGCCTAGG - Intronic
953399574 3:42600953-42600975 GAGGGGGAGAAAAGCGGTCAGGG - Intronic
953789856 3:45939036-45939058 GGGGAGGAGGAAAGCCGCGTGGG - Intronic
953828037 3:46271093-46271115 GAGGAGGAGTAAAGCAGCCAGGG - Intergenic
953877264 3:46673493-46673515 AAGGGGAAGGAGATCAGCCTAGG + Intronic
954463755 3:50642465-50642487 GAGGCTGAGAAAAGCAGTCTGGG - Intronic
954580520 3:51700653-51700675 GAGGGGGAGGCAGGCAGCAGAGG - Intronic
954797253 3:53167949-53167971 GAGGGGGAGAAGAGCAGGCAGGG - Intronic
954930992 3:54281125-54281147 GAGGAGGAGGACAGCACCATGGG + Intronic
955578869 3:60397288-60397310 CTGGGGGAGGAAAGCAGGGTAGG + Intronic
955831038 3:63004564-63004586 GAGGAGAAGAGAAGCAGCCTGGG - Intergenic
956059981 3:65339602-65339624 AAGGGGCTGGAAAGCAGCCAGGG + Intergenic
956737237 3:72247217-72247239 GAGGCAGAGGAAAGTAGCCAAGG + Intergenic
957085340 3:75672031-75672053 GAGGGGGAGCAACAGAGCCTTGG + Intergenic
958009280 3:87855414-87855436 AAAGGTGTGGAAAGCAGCCTTGG - Intergenic
959317379 3:104824535-104824557 CAGGGGGTGGAGACCAGCCTGGG - Intergenic
959602481 3:108203250-108203272 AAGGGAGAGGAAAGCAGGATTGG - Intronic
959614489 3:108331834-108331856 GAGGGGGAGGCAGGCAGCAGAGG - Intronic
961243011 3:125428738-125428760 GAGGGGGTGCACAGGAGCCTGGG - Intergenic
961484090 3:127205389-127205411 GAAGGGGAGGAAAGCAGATGTGG + Intergenic
961617572 3:128195015-128195037 GAGGAGGAGAAAAGCAGCACTGG - Intronic
962207891 3:133450096-133450118 GAGAGGGAGAAATGCATCCTTGG + Intronic
962345738 3:134618007-134618029 TAGGGGGTGGGAAGCAGCCTGGG + Intronic
963914343 3:150844023-150844045 GACAGGGAAGAATGCAGCCTAGG - Intergenic
966129857 3:176625115-176625137 CAGTGGGAGAGAAGCAGCCTGGG + Intergenic
966167869 3:177041424-177041446 GGGGGGGAGGGAAGAAGCCAAGG - Intronic
966734707 3:183179607-183179629 GAGAGGGGAGAAAGCAGCCAGGG - Exonic
966904555 3:184512865-184512887 GAGGGAGAGGAAAGTAGCCAAGG + Intronic
966919489 3:184602484-184602506 GAGGGAGAGGAGAGAAGCCCAGG - Intronic
966923128 3:184627378-184627400 GTGGGGGTGGGAAGCAGCCCCGG + Intronic
966989044 3:185210092-185210114 GCGGAGGAGGAAGGCAGGCTGGG + Intronic
967247184 3:187499882-187499904 CAGGAGTTGGAAAGCAGCCTGGG - Intergenic
967367824 3:188707791-188707813 GAGAGGGAGCAGAGCAGGCTAGG - Intronic
967717880 3:192784050-192784072 AAGGGGGAGGGCAGCAGCCCAGG + Intergenic
968849625 4:3070018-3070040 GAGGGGGTGCACACCAGCCTGGG - Intergenic
969175788 4:5398092-5398114 CAGGGAGAGGTGAGCAGCCTGGG + Intronic
969290930 4:6239640-6239662 GGCGGTGAGGAAAGCTGCCTGGG - Intergenic
969428827 4:7141100-7141122 GAGTGGGAGGGAAGCGGCCTGGG - Intergenic
969657946 4:8508854-8508876 GAGGAGGAGGAAGGCAGCCAAGG - Intergenic
969725432 4:8915593-8915615 GAGGGGCAGGGATGCAGCCGTGG + Intergenic
970193081 4:13533464-13533486 GAGGGGGAGGAAAGGAGGTAAGG - Intergenic
972478193 4:39472962-39472984 GAGGGAGAGGACAAAAGCCTGGG + Intronic
973286476 4:48422596-48422618 GGGTGGGAGGAAAGAAACCTGGG + Exonic
974865705 4:67578526-67578548 GAGGGAGAGGAAGGAATCCTGGG + Intronic
975418956 4:74139600-74139622 GACTGGGAGGAAAGCAGTCTTGG + Intronic
975740628 4:77425782-77425804 GAAGGAGAAGAAAGCAGCCCAGG - Intronic
976151979 4:82101546-82101568 GGGAGGGAGGAAACCAGCATTGG + Intergenic
976625716 4:87179564-87179586 CAGGAGGTGGAAACCAGCCTGGG + Intronic
976633840 4:87267511-87267533 GATGGAGAGGAAAGAAGCCTGGG - Intergenic
977252384 4:94703681-94703703 GAGGAGTAGGAGACCAGCCTAGG + Intergenic
977916645 4:102601692-102601714 CAGGGAGAGGCAAGGAGCCTGGG + Intronic
978384674 4:108167845-108167867 GTGGGGGAGGAAAGGAGAGTTGG + Exonic
979620929 4:122797865-122797887 CAGAGGGAGGAAAGCAGCTCAGG - Intergenic
980073134 4:128264624-128264646 GAGGGGTAGGCCACCAGCCTTGG - Intergenic
980910339 4:138988375-138988397 GAGGCGGAGGTAGGCAGCCATGG - Intergenic
981494580 4:145377038-145377060 GAGAGGGAGGAAAGCACATTCGG - Intergenic
982112584 4:152070495-152070517 GAAGGGGAGTAAAGCTGCCTGGG + Intergenic
983780428 4:171663508-171663530 GTGGGGAAGGAAAGCAGTCCAGG + Intergenic
984141242 4:176005883-176005905 GAGGGGGAGAAGAGGAGCCCGGG + Intergenic
984600569 4:181721655-181721677 GAGGAAGAGGAATGCAGCCAGGG + Intergenic
984671073 4:182488225-182488247 GAGAGGCAGGAAAGGAGTCTAGG + Intronic
984760080 4:183356378-183356400 GAGGGGGAGGAAAGAAGGGAGGG - Intergenic
984768715 4:183419542-183419564 GAGGAGGAGGAAAGCAGTCTGGG - Intergenic
984935103 4:184882943-184882965 GAGAGGGAGGAAAACTGCCACGG - Intergenic
984965253 4:185134253-185134275 CAGGGGTTGGAGAGCAGCCTGGG - Intergenic
985387781 4:189465337-189465359 GGGGTGGAGCTAAGCAGCCTGGG + Intergenic
985387799 4:189465421-189465443 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985387818 4:189465505-189465527 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985387828 4:189465547-189465569 GAGGTGGAGCTAAGCAGCCTGGG + Intergenic
985387863 4:189465694-189465716 GAGGTGGAGCTAAGCAGCCTGGG + Intergenic
985387883 4:189465778-189465800 GAGGTGGAGCTAAGCAGCCTGGG + Intergenic
985387889 4:189465799-189465821 GGGGTGGAGCTAAGCAGCCTGGG + Intergenic
985387899 4:189465841-189465863 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985387917 4:189465925-189465947 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985387931 4:189465988-189466010 GAGGTGGAGCTAAGCAGCCTGGG + Intergenic
985387947 4:189466072-189466094 GAGGTGGAGCTAAGCAGCCTGGG + Intergenic
985387956 4:189466114-189466136 GACGTGGAGCTAAGCAGCCTGGG + Intergenic
985387962 4:189466135-189466157 GGGGTGGAGCTAAGCAGCCTGGG + Intergenic
985387973 4:189466177-189466199 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985387982 4:189466219-189466241 GAGGTGAAGCTAAGCAGCCTGGG + Intergenic
985387992 4:189466261-189466283 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985388010 4:189466345-189466367 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985388032 4:189466450-189466472 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985388048 4:189466513-189466535 GAGGTGGAGGTAAGCAGCCTGGG + Intergenic
985388054 4:189466534-189466556 GGGGTGGAGCTAAGCAGCCTGGG + Intergenic
985388068 4:189466597-189466619 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985388095 4:189466702-189466724 GAGGTGGAGCTAAGCAGCCTGGG + Intergenic
985388105 4:189466744-189466766 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985388122 4:189466807-189466829 GAGGTGGAGGTAAGCAGCCTGGG + Intergenic
985388129 4:189466828-189466850 GGGGTGGAGGTAAGCAGCCTGGG + Intergenic
985388136 4:189466849-189466871 GGGGTGGAGGTAAGCAGCCTGGG + Intergenic
985388146 4:189466891-189466913 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985388156 4:189466933-189466955 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985388170 4:189466996-189467018 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985388179 4:189467038-189467060 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985388189 4:189467080-189467102 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985388198 4:189467122-189467144 GAGGTGGAGCTAAGCAGCCTGGG + Intergenic
985388208 4:189467164-189467186 GAGGTGGAGCTAAGCATCCTGGG + Intergenic
985388217 4:189467206-189467228 GAGGTGAAGCTAAGCAGCCTGGG + Intergenic
985900033 5:2780936-2780958 GAGGGTGAGGAAGGCGGCCAGGG - Intergenic
987243427 5:16024372-16024394 GAGCAGGAGCAAGGCAGCCTGGG - Intergenic
988493125 5:31721961-31721983 GAGAGGGAGGAACGAAGGCTGGG - Intronic
990189484 5:53242928-53242950 GAGGTGGAGGAAAGTAGCTGTGG - Intergenic
991436040 5:66597418-66597440 GAGGGGGAGAAATGGTGCCTTGG + Intronic
992224906 5:74610818-74610840 GAGGGAGATGGAAGCAGGCTTGG - Intergenic
992676593 5:79111936-79111958 GAGGGGAAGGAGAGCGCCCTCGG - Intronic
993699100 5:91097250-91097272 AAGGGGCAGGACAGCACCCTGGG + Intronic
994117017 5:96072186-96072208 AGGAGGGAGGAAAGAAGCCTTGG + Intergenic
994478037 5:100295684-100295706 GAGGGTCAGGAAAGAATCCTGGG + Intergenic
994858458 5:105156930-105156952 AAGGTGGAGGAAAGCAGGCTAGG - Intergenic
995219206 5:109629030-109629052 GAGGGGGCAGAAAGCAGTTTAGG - Intergenic
995449488 5:112284870-112284892 AAGGTGGATGAAAGCAGCCAAGG - Intronic
995525550 5:113047930-113047952 GAGGAGGAGGAAGGAAGCCTTGG - Intronic
995800481 5:115988746-115988768 GAAGGGATGGAAACCAGCCTCGG + Intronic
995896955 5:117025217-117025239 CAGGGAGAGGAAAACAACCTGGG + Intergenic
997113275 5:131098648-131098670 GAGGAGGAGAAAAGGAGCCCAGG + Intergenic
997474595 5:134135372-134135394 GAGGGGCAGGAGAGAAGCATGGG + Intronic
997510521 5:134450686-134450708 GAGGGAGAGGAAGGCAACCCTGG + Intergenic
997835025 5:137185155-137185177 GAGGGGGAGGGAAGAAGAGTTGG + Intronic
999104466 5:149058647-149058669 AAGTGGGAGGAAAGCAGGATGGG + Intronic
999114296 5:149148898-149148920 GAGGGTGAGGAGGCCAGCCTTGG - Intronic
999329800 5:150665221-150665243 GGGAAGGAGGAATGCAGCCTAGG + Intronic
1000672210 5:164076939-164076961 GAGGAGGAGGAAGGCAGCCCTGG - Intergenic
1000937574 5:167321608-167321630 GAAGGGGAGCAAAGCAGCTTAGG + Intronic
1001206684 5:169769760-169769782 GAGGGAAAGGAAAGCAGTGTGGG + Intronic
1001285394 5:170419322-170419344 GAGGTGGAGGAAGGAAGCCAAGG + Intronic
1001681781 5:173563243-173563265 GACTGGGAGAAAAGCAGGCTTGG + Intergenic
1001797758 5:174516156-174516178 GAGGGGGAAAAAAGAAGCCGTGG - Intergenic
1001873417 5:175178466-175178488 GAGGGGGAGAAAAGGACACTTGG + Intergenic
1001933568 5:175689311-175689333 GAGGGGGAAGAAGGGGGCCTGGG - Intergenic
1002080416 5:176734072-176734094 GTGGGGGCGGGAGGCAGCCTGGG + Intergenic
1002128765 5:177066293-177066315 GAGGGGCAGGAAAGGAGACAAGG + Intronic
1002311085 5:178314213-178314235 GGGGGGGACGTAAGCAGCTTCGG - Intronic
1002473748 5:179452544-179452566 GAGGGGGCTGAAGGCAGCCATGG - Intergenic
1003053173 6:2797837-2797859 GAGGAGGAGGAGATCTGCCTTGG - Intergenic
1003126219 6:3357969-3357991 GAGGGGAAGGGAAGAGGCCTGGG + Intronic
1003446713 6:6191543-6191565 GGTGGGGTGGAAAGCAGGCTTGG + Intronic
1003480212 6:6524365-6524387 CAGGAGTTGGAAAGCAGCCTGGG + Intergenic
1004744692 6:18498308-18498330 TAGGGGAAGGAAGGCAGCCTTGG - Intergenic
1005725693 6:28645844-28645866 TAGAGGGAGGAAAGCATCTTTGG + Intergenic
1006383885 6:33718090-33718112 GGGAGGGGGAAAAGCAGCCTGGG - Intergenic
1006470764 6:34227410-34227432 GGAGGGGAGGAAAGCAGAGTGGG - Intergenic
1006503505 6:34473307-34473329 GCTGGGGAGGAAATCAGCATAGG + Intronic
1006734579 6:36263930-36263952 TAGGGGCAGGGAAGCAGCTTAGG - Intronic
1007084753 6:39135557-39135579 AAGGGGGTGGTAAGCAGCCCTGG + Intergenic
1007177886 6:39909124-39909146 GAGGGAGAGGAAAGCAGGGGAGG + Intronic
1007177896 6:39909151-39909173 GAGGGAGAGGAAAGCAGGGGAGG + Intronic
1007177915 6:39909205-39909227 GAGGGAGAGGAAAGCAGGGGAGG + Intronic
1007177928 6:39909237-39909259 GAGGGAGAGGAAAGCAGGGGAGG + Intronic
1007177942 6:39909270-39909292 GAGGGAGAGGAAAGCAGGGGAGG + Intronic
1007239877 6:40417166-40417188 GGAGGAGAGCAAAGCAGCCTTGG + Intronic
1007273220 6:40654203-40654225 AAGGGTGAGGGAAGCTGCCTAGG + Intergenic
1007420275 6:41715052-41715074 GAGGAGCAGGAGAGCAGCATGGG + Intronic
1008689224 6:53958927-53958949 GAAGGGGAAAAAAGTAGCCTGGG + Intronic
1010931549 6:81810032-81810054 CAGGAGCTGGAAAGCAGCCTGGG + Intergenic
1011099706 6:83708422-83708444 GAGGAGGAGGGAGGCAGCCAGGG - Intronic
1013011790 6:106127192-106127214 GAGAAGGAGGAAAGAAGCCGTGG - Intergenic
1013366425 6:109441219-109441241 TAGGGGGAGGAAGGCTGCATGGG - Intronic
1013803452 6:113971474-113971496 GTGGGGGAGGGGAGCAGCGTGGG - Intronic
1014320298 6:119919847-119919869 GAGAGGGAGGGAAGCAGACCAGG - Intergenic
1015412969 6:132915220-132915242 GAAGGGGAGTAAAGAAGCCTGGG + Intergenic
1015748921 6:136540396-136540418 GAGGGAGAGGAAGGCAGTGTAGG + Intronic
1016060437 6:139624264-139624286 GAGTGGGAAGTTAGCAGCCTGGG + Intergenic
1016881601 6:148917180-148917202 GAGGGGGAAGAAAGGAGGGTGGG - Intronic
1016910358 6:149192731-149192753 GAGGGAGAGGGAAGCAGGATTGG - Intergenic
1017017439 6:150113208-150113230 AAGGGGGAAGAAAGGAGGCTGGG - Intergenic
1017519362 6:155187900-155187922 GCAGGTGTGGAAAGCAGCCTTGG + Intronic
1017848338 6:158279708-158279730 GAGGAGGAGGAAAGAGGCCAAGG - Intronic
1018618557 6:165709518-165709540 GAGGGAGAGCGAAGCAGCATGGG - Intronic
1018713394 6:166513689-166513711 AAGGGGGAAGCAAGCAACCTGGG + Intronic
1018813856 6:167316662-167316684 GAAGGGGAAGGAAGCAGCTTAGG - Intergenic
1018906627 6:168079564-168079586 GGGCGGGAGGAAGGCAGCCTGGG + Intronic
1018964517 6:168474148-168474170 GGTGGGGAGGAAAGCCCCCTGGG + Intronic
1019034217 6:169041229-169041251 AAGGGGCAGGAAAGCAGGCCTGG + Intergenic
1019469657 7:1211910-1211932 CAGGGGGATGAAGGCAGCCAGGG + Intergenic
1019570972 7:1711982-1712004 TAGGGCGAGGACAGCAGACTGGG + Intronic
1019615561 7:1958096-1958118 GAGGGACAGGAAAGCAACCTCGG + Intronic
1019746055 7:2700917-2700939 GGGTGGGAGGAAGGAAGCCTTGG - Intronic
1020311661 7:6873056-6873078 CAGGGGTCGGAACGCAGCCTGGG - Intergenic
1020926060 7:14326218-14326240 AAGCTGAAGGAAAGCAGCCTGGG + Intronic
1021685604 7:23182534-23182556 GAGGGTGAGGCTAGCAGCTTGGG + Intronic
1021786388 7:24156810-24156832 GAGGGGGAAGGAAGCAGGGTTGG - Intergenic
1021791815 7:24213530-24213552 GAAGAGGAGGAAAGCAGACCTGG + Intergenic
1021969160 7:25950710-25950732 GAGGGGGAGAAGAGCAGTCTTGG - Intergenic
1022686957 7:32606116-32606138 CAGGAGGAGGAGACCAGCCTGGG - Intergenic
1022943317 7:35259082-35259104 GAGGGGGAGAAAAGCGGACAAGG + Intergenic
1023086096 7:36571407-36571429 AAGGGGCTGGAGAGCAGCCTTGG - Intronic
1023175929 7:37435364-37435386 CAGGGGGTGGAAACCACCCTAGG - Intronic
1024115095 7:46185307-46185329 GAGGACGAGGGATGCAGCCTGGG - Intergenic
1025024481 7:55505178-55505200 GAGGAGGAGCAAAGTTGCCTGGG - Intronic
1026715113 7:72782073-72782095 GAGGAGTTGGAAACCAGCCTGGG + Intronic
1026976058 7:74499162-74499184 GAGTGGGAGGAACACAGCCTGGG - Intronic
1028482703 7:91325161-91325183 GAGTGGTAGGAGAGCAGGCTTGG + Intergenic
1029004136 7:97189484-97189506 AAGGCTGAGGAAAGCTGCCTAGG - Intergenic
1029090102 7:98041139-98041161 GAGAGTGAGGAAGGCAGGCTGGG - Intergenic
1029491915 7:100875329-100875351 GTGGGGGAGGGGAGGAGCCTGGG + Intronic
1029587878 7:101486977-101486999 GAGGGGGAGGAAGGGAGCCTGGG + Intronic
1030650151 7:112108978-112109000 GGGGAGGAGGAGAGCAGCCATGG + Intronic
1032579950 7:133095267-133095289 GAGGGCAGGGAAACCAGCCTTGG - Intergenic
1032643214 7:133792943-133792965 GAAGGTAAGGAGAGCAGCCTGGG - Intronic
1033730762 7:144176738-144176760 GAATGGGAGGCAAGCAGCCCTGG + Intergenic
1033916617 7:146334192-146334214 GAGGCTGAGGAAAGCAGATTAGG + Intronic
1034684621 7:152959081-152959103 GAGGGGTAGGAACGCATCCTGGG + Intergenic
1034892790 7:154855480-154855502 GTGAGGCTGGAAAGCAGCCTGGG - Intronic
1035247058 7:157569441-157569463 GAAGGGGTGGCAGGCAGCCTAGG - Intronic
1035388456 7:158489841-158489863 GGGGGCCAGGAAGGCAGCCTCGG - Intronic
1035569593 8:663234-663256 GAGGGAGGGGAAGGAAGCCTTGG - Intronic
1036201290 8:6773493-6773515 ACGGGGGAGGGACGCAGCCTGGG - Intergenic
1036206642 8:6810413-6810435 GATGGGGTGGAAAGCAGCAGTGG + Exonic
1036279350 8:7386353-7386375 GAGAGGGAGGAAAGCAGGGAGGG - Intergenic
1036342164 8:7925519-7925541 GAGAGGGAGGAAAGCAGGGAGGG + Intergenic
1036644039 8:10601179-10601201 GAGGGAGGGGACAGCAGGCTAGG + Intergenic
1037588605 8:20294985-20295007 GTGTGGGAGGCAAGGAGCCTGGG + Intronic
1037768987 8:21788072-21788094 GAGGGGGAGGCGAGAAGCCGGGG - Intronic
1038053873 8:23839268-23839290 GATGGGGAGGAAAGGAACTTAGG + Intergenic
1039567595 8:38562514-38562536 GAGGGGGAAGTAAGAAACCTGGG + Intergenic
1039794681 8:40902775-40902797 GAGGGGCAGGAAAGCTGCTCTGG + Intergenic
1040278767 8:46027031-46027053 GTGTGCGAGGAAAGCACCCTTGG + Intergenic
1040745741 8:50640246-50640268 GGGAGGGAAGAAAACAGCCTGGG - Intronic
1041329935 8:56713908-56713930 GAGGGGCAGGAAAGCTGTCTGGG - Intergenic
1041490456 8:58426863-58426885 GAGGAGGAGCAAGCCAGCCTAGG - Intronic
1043123166 8:76357044-76357066 GAGGGTGGGGATAGCAGTCTAGG + Intergenic
1044516369 8:93143383-93143405 TAGGGTGAGCAAGGCAGCCTGGG - Intronic
1044535777 8:93354970-93354992 GAAGGTGAAGAAAACAGCCTGGG + Intergenic
1045317160 8:101053117-101053139 CAGGGGCAAGAAAGCAGTCTTGG - Intergenic
1046766349 8:118074156-118074178 GAGGGGGAGGGAAGAAGGATGGG + Intronic
1046949795 8:120008944-120008966 GAGGGAGAGAAAACCAGCCCAGG - Intronic
1047312838 8:123706824-123706846 AAGTGGGTGGAAAGTAGCCTGGG - Intronic
1048855744 8:138685284-138685306 GCGGGGGAAGAAGGCAGCCCAGG - Exonic
1049124746 8:140776637-140776659 GAAGGGGAGAGAAGCAGGCTTGG + Intronic
1049445366 8:142628000-142628022 GAGGCTCAGCAAAGCAGCCTGGG - Intergenic
1049582655 8:143419942-143419964 TAGGGGGAGGAAAGCCTTCTGGG + Intronic
1049842834 8:144784912-144784934 CAGGAGTAGGAAACCAGCCTGGG + Intronic
1050243423 9:3661461-3661483 CAGAGAGAGGAAAGCAGGCTTGG - Intergenic
1051367830 9:16333752-16333774 GATGGGGAAGAAAAGAGCCTGGG + Intergenic
1053423429 9:37995628-37995650 GACGGTGAGGAAAGCAAGCTAGG - Intronic
1053424764 9:38003639-38003661 GAAGGGGAGGACAGGAGCATGGG + Intronic
1053480957 9:38415865-38415887 GAGGGGGAGGAAAGCAGCCTGGG - Intronic
1053782997 9:41630234-41630256 CAGGGGAAAGACAGCAGCCTGGG + Intergenic
1054170950 9:61840376-61840398 CAGGGGAAAGACAGCAGCCTGGG + Intergenic
1054351956 9:64025509-64025531 TAGGGGGAGGAAAGGAGGCAAGG - Intergenic
1054666586 9:67740436-67740458 CAGGGGAAAGACAGCAGCCTGGG - Intergenic
1055640810 9:78317457-78317479 CAGGAGTTGGAAAGCAGCCTAGG - Intronic
1055763360 9:79633833-79633855 GAGAGGGAGGGAAGAAGCATGGG + Intronic
1055867112 9:80828008-80828030 AAGGGGGAAGAAAACAGCCTAGG - Intergenic
1056143830 9:83709442-83709464 TAGGTAGAGGAAGGCAGCCTAGG - Intergenic
1056443377 9:86641824-86641846 CAGAGGGAGGAAAGGTGCCTTGG - Intergenic
1056877416 9:90347823-90347845 GAGAGGTAGGAAACCATCCTGGG + Intergenic
1056917323 9:90757053-90757075 GAGGGGTCGGAATGCAGCCCTGG - Intergenic
1056926712 9:90840400-90840422 GAGTGGGGGAAAAGCAGGCTGGG + Intronic
1057313212 9:93954404-93954426 GCGGGCGAGGAACGCGGCCTTGG - Intronic
1058478399 9:105364781-105364803 GAGGGGAAGGGAATCAGACTGGG + Intronic
1059038336 9:110784856-110784878 GAGGAGGAGGAAGGCAGATTTGG - Exonic
1059308886 9:113375089-113375111 CAGGGGTTGGAGAGCAGCCTGGG - Intronic
1060726358 9:126008546-126008568 GGGAGGGAGGAAAGCAGGATAGG + Intergenic
1060830975 9:126716259-126716281 CAGGGGGTGGAGACCAGCCTGGG + Intergenic
1060932308 9:127496893-127496915 GTGGGGGAGGAGAGAAGCCTTGG - Intronic
1061007281 9:127935297-127935319 CAGGGTAAGGAAAGCTGCCTTGG + Exonic
1061077010 9:128347926-128347948 GAGAGGGAAGAAGGCAGCCAGGG + Intronic
1061402960 9:130378396-130378418 GAGGGGGAGGCAGGGAGGCTGGG + Intronic
1061616368 9:131782484-131782506 GAGGGGAAGGAAAGGAGCCAAGG - Intergenic
1061733782 9:132638033-132638055 AAGGTGGAGGAAAGCAGCACAGG + Intronic
1062016078 9:134292036-134292058 AAGGGGCAGGAGGGCAGCCTGGG + Intergenic
1062131048 9:134893335-134893357 CTGGGAGAGGAAAGAAGCCTAGG - Intergenic
1062244248 9:135555975-135555997 GAGGGGCAGGAAGGAAACCTCGG - Intergenic
1062473074 9:136714701-136714723 GAGGGGGCGGAGACCAACCTGGG + Intronic
1062520558 9:136955970-136955992 GAGGCGGTGACAAGCAGCCTCGG + Intronic
1062543624 9:137052357-137052379 GAGGGGGAGGGAGTCAGCCTGGG + Intronic
1062662605 9:137646500-137646522 CAGCAGGTGGAAAGCAGCCTTGG + Intronic
1203759459 EBV:4517-4539 GAGGTGGAGGAGCGCAGCGTGGG + Intergenic
1203372489 Un_KI270442v1:321603-321625 GAGGGGGAGCAACAGAGCCTTGG - Intergenic
1185612858 X:1402670-1402692 GAGGGGGAAGGAAGCTGCATTGG - Intergenic
1185734172 X:2484982-2485004 AAGGGTGAGGAAAACAGCTTGGG - Intronic
1185835966 X:3346229-3346251 GAGAGGGAGGAAAGGAGGCATGG + Intronic
1186126784 X:6422868-6422890 GAAGGGCAGGACAGCAGGCTAGG + Intergenic
1186807250 X:13152729-13152751 TGCGGGGAGGAGAGCAGCCTGGG + Intergenic
1187283771 X:17883219-17883241 GAAGGGGTGGAAATCATCCTTGG + Intergenic
1187419225 X:19121163-19121185 GAGGGGGAGAAGAGGAGGCTTGG - Intronic
1187739121 X:22336237-22336259 GAAAGGAAGGAATGCAGCCTGGG - Intergenic
1188157321 X:26755957-26755979 GAGGGGGTGGAAGTCAGCCGTGG + Intergenic
1188298973 X:28484183-28484205 GAGTGGGAGCAAGGCAGCATGGG + Intergenic
1189288316 X:39867528-39867550 GAGGGGGAGGGGAGGAGCCCTGG - Intergenic
1190089492 X:47425389-47425411 GAGGAGTTGGAAACCAGCCTGGG + Intergenic
1192150603 X:68710013-68710035 AAGGAGCAGGAAAACAGCCTGGG + Intronic
1193333320 X:80259670-80259692 GTGGGGGAGGAAGGCAGACAGGG + Intergenic
1194294616 X:92113156-92113178 GAGGGGAAGGAAGGGAGCCAAGG - Intronic
1195065477 X:101234975-101234997 TTGGAGGAGGAAATCAGCCTGGG - Intronic
1195667052 X:107441031-107441053 GAGAGGGTGGAAAGCAACATAGG + Intergenic
1197770145 X:130084391-130084413 GTGGGGGAGGGAGGCAGCCAGGG + Intronic
1200056878 X:153466183-153466205 AAGGGGGAGGCCAGCAGGCTGGG + Intronic
1200394820 X:155978200-155978222 GAGGGGGGGGAAAGAAGAGTTGG - Intergenic
1201153844 Y:11112081-11112103 GGGGGGGAGGAAAGGAGGCAAGG - Intergenic
1201486781 Y:14503365-14503387 GAAGGTGAGAAAAGCTGCCTTGG + Intergenic
1201608382 Y:15813118-15813140 GAAGGGCAGGACAGCAGGCTGGG + Intergenic
1202061892 Y:20897385-20897407 AAGGGGGTGGTGAGCAGCCTTGG - Intergenic