ID: 1053480958

View in Genome Browser
Species Human (GRCh38)
Location 9:38415866-38415888
Sequence AGAGGGGGAGGAAAGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 918
Summary {0: 1, 1: 0, 2: 11, 3: 84, 4: 822}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480958_1053480970 28 Left 1053480958 9:38415866-38415888 CCAGGCTGCTTTCCTCCCCCTCT 0: 1
1: 0
2: 11
3: 84
4: 822
Right 1053480970 9:38415917-38415939 CCCATCTGAGGGCCCTCTGAAGG No data
1053480958_1053480967 16 Left 1053480958 9:38415866-38415888 CCAGGCTGCTTTCCTCCCCCTCT 0: 1
1: 0
2: 11
3: 84
4: 822
Right 1053480967 9:38415905-38415927 CATTCAGCTGTACCCATCTGAGG No data
1053480958_1053480968 17 Left 1053480958 9:38415866-38415888 CCAGGCTGCTTTCCTCCCCCTCT 0: 1
1: 0
2: 11
3: 84
4: 822
Right 1053480968 9:38415906-38415928 ATTCAGCTGTACCCATCTGAGGG No data
1053480958_1053480972 29 Left 1053480958 9:38415866-38415888 CCAGGCTGCTTTCCTCCCCCTCT 0: 1
1: 0
2: 11
3: 84
4: 822
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480958 Original CRISPR AGAGGGGGAGGAAAGCAGCC TGG (reversed) Intronic
900227717 1:1540681-1540703 AGAGGCGGAGGAAGGCGGCGGGG - Intergenic
900265649 1:1755807-1755829 AGATGGGGAGAAAAGCAGGGCGG + Intronic
900400648 1:2471634-2471656 GCAGGGGGAGGACAGCAGCCAGG - Intronic
900435483 1:2628882-2628904 AGCGGGGGAGTGAGGCAGCCAGG + Intronic
901627196 1:10631061-10631083 AGACTGGGAGGAAAAGAGCCAGG - Intergenic
901831597 1:11895709-11895731 ACAGGAGGTGGAGAGCAGCCTGG + Intergenic
902201393 1:14836222-14836244 AGAGAGGGTGGAGAGAAGCCAGG + Intronic
903291993 1:22319819-22319841 AGAGAGGGAGGTACCCAGCCAGG + Intergenic
903301779 1:22384271-22384293 AAAGGGGTAGGAGAGGAGCCTGG + Intergenic
903573581 1:24323760-24323782 AGAGGGGGAGGCAGCCAGCCAGG - Intronic
903737804 1:25541398-25541420 AGAAGGGGAGGAAAGGAGGGAGG + Intergenic
905451520 1:38060079-38060101 AGAGGGCGTGGTGAGCAGCCTGG + Intergenic
905479160 1:38249310-38249332 AGGTGGGGAGGAAACCCGCCAGG - Intergenic
906192342 1:43906100-43906122 AGAGGGGGAGGAAAAGTGGCAGG - Intronic
906223674 1:44103564-44103586 AGAGGGCGAGGAGAGCCGGCTGG - Intergenic
906237184 1:44219112-44219134 GGAGCGGGAGAAACGCAGCCAGG + Exonic
906518461 1:46453333-46453355 AGAGAGGGAGAGAGGCAGCCCGG + Intergenic
907285506 1:53377032-53377054 AGAGCGGCAGGAAAGCGCCCTGG + Intergenic
907327249 1:53646849-53646871 AGAGGGGAAGGAAAGAAGGAAGG + Intronic
907527597 1:55062995-55063017 AGAGGGGGAGGATGGCACCAAGG + Intronic
908000233 1:59672175-59672197 AGAGGGGAAGGACAGATGCCAGG - Intronic
908358341 1:63344049-63344071 AGAGGGGGAGAAGGGCAGCAGGG - Intergenic
908479610 1:64525499-64525521 AGTGTGGGAGGAAAGAAGCCAGG - Intronic
908622452 1:65999366-65999388 AGAGGAGGTTGGAAGCAGCCTGG - Intronic
910363244 1:86436348-86436370 AGGGAGGGAGGAAGGCAGGCAGG - Intronic
910393125 1:86764472-86764494 GGAAGGAGTGGAAAGCAGCCAGG + Intergenic
911044210 1:93615458-93615480 AGTGAGGGAGGAAAGCAGAAAGG - Intronic
912168551 1:107069464-107069486 GGAGGGGGAGGAAAGGAGAAAGG + Intergenic
912472961 1:109918287-109918309 GGAGGGGGAGGAGAGAAGTCAGG + Intronic
912519046 1:110232945-110232967 AGAGGGTGAGGACTTCAGCCTGG - Exonic
912543948 1:110437633-110437655 AGAGTGGGGGGAAAGAAGCAAGG + Intergenic
912676806 1:111689307-111689329 AGAGAGGGAAGAAAGAAGCAAGG - Intronic
912876995 1:113370436-113370458 GGAGGGGGAAGAATGGAGCCTGG - Intergenic
913059168 1:115188924-115188946 ATAGAGGGAGGAAAGCTTCCAGG - Intergenic
913189508 1:116401593-116401615 AGTAGGAAAGGAAAGCAGCCAGG - Exonic
914320762 1:146557271-146557293 AGATGGGGAGGAAAGGAGACAGG - Intergenic
914743890 1:150487101-150487123 AGAGTGGGAGAAAACCAGACAGG - Intergenic
915284820 1:154845960-154845982 ACAAGGGTAGGAAAGGAGCCAGG - Intronic
915287947 1:154864764-154864786 AGAGGGGCAGGAAATCAGTGGGG + Intronic
915311231 1:155006793-155006815 AAAGGGGGAGGAAAGGAGGAAGG - Intronic
915897790 1:159824997-159825019 GGAGTGGGAGGACAGCAGGCAGG - Intergenic
915985501 1:160460264-160460286 AGAGGGGGTGCAAAGCACACAGG + Intergenic
916029244 1:160862156-160862178 GGAGGGCGAGGCCAGCAGCCAGG - Intronic
916752919 1:167739965-167739987 AGCGGGAGAGGGAAGCAGCCAGG - Intronic
918119092 1:181521935-181521957 AGAGGGGTTGGAAAGTAGGCAGG + Intronic
918133070 1:181646020-181646042 AGTGGGGAAGGAAAGAGGCCAGG - Intronic
918354435 1:183693468-183693490 AGAGAGGGAGGAAAGAAGAAAGG - Intronic
918412134 1:184270873-184270895 AGAGGGGAAGGAAAGAGGACTGG - Intergenic
919509785 1:198447694-198447716 AGAGAGGGAGGAAAGAAGAGAGG - Intergenic
919750853 1:201037213-201037235 GGAGGGGGAGGTAGGCATCCAGG + Intergenic
919931583 1:202224747-202224769 AGAGAGGGAGGTGAGCAGGCTGG - Intronic
919938283 1:202269291-202269313 AGAGAGGGAGGCAACCAGGCTGG + Intronic
919978727 1:202629291-202629313 ACAGGGGCAGGAAAGAAGCCAGG - Intronic
920122287 1:203667760-203667782 AGGGAGGGAAGACAGCAGCCTGG + Intronic
920203383 1:204274614-204274636 GGAGGGGAAGGAAAGCAGAAGGG - Intronic
920314555 1:205068134-205068156 GGAGGGGGAGAAAAGAACCCAGG + Intronic
920555874 1:206904126-206904148 GCAGGGGAAGGAAAGCAGTCAGG - Intronic
920704100 1:208239394-208239416 AGAGAGGGAGGAAGACAGCAAGG - Intronic
920715000 1:208331888-208331910 ACAGCGGGAGGGAAGCAGCAGGG - Intergenic
921359925 1:214321853-214321875 AGAAGGGAAGGAAAGCTGGCAGG + Intronic
922022325 1:221717306-221717328 AGAGGGGAAGGAAGGGAGGCAGG + Intronic
922470544 1:225874534-225874556 AGGGGGTGAGCAAAGCATCCGGG - Intronic
922560853 1:226568649-226568671 AGAGGGGGCAGCAGGCAGCCAGG - Intronic
922730587 1:227947068-227947090 AGAGGGGGAGGGAAGAAGGAAGG + Intronic
922738903 1:228004959-228004981 TGGGGGAGAAGAAAGCAGCCAGG + Intergenic
922891520 1:229065627-229065649 AGGGAGGGAGGAAAGGAGGCTGG - Intergenic
923027292 1:230215409-230215431 AGAGAGCTAGCAAAGCAGCCAGG - Intronic
923036403 1:230287851-230287873 AGAGAGGGAGGACAGGGGCCTGG + Intergenic
923273792 1:232379689-232379711 AGAGGGAGAGGCAGGCACCCAGG + Intergenic
923318507 1:232805517-232805539 AGCGGGGGACGGCAGCAGCCGGG - Exonic
923332974 1:232942654-232942676 AGAGAGGGAGGAAAGGAGATAGG + Intergenic
923376997 1:233373906-233373928 AGAGGGGAAGGAAAGTAGGAAGG + Intronic
923474184 1:234317368-234317390 AGTGAGGGGGGAGAGCAGCCAGG - Intronic
923701225 1:236302108-236302130 AGAGGGAGAGGGAAGAACCCAGG - Intergenic
924152021 1:241139261-241139283 AGATGGGGAGGAAAGGAGAGTGG - Intronic
924360543 1:243236792-243236814 ACAATGGGAGGAAAGCAGTCTGG + Intronic
924455980 1:244219312-244219334 AGATGGGCAGGAGAGCAGCAAGG - Intergenic
924689717 1:246334556-246334578 CGAGGGGGAGGTAAGAAGCAGGG + Intronic
1063130209 10:3171808-3171830 GGAGGGGGATCAAACCAGCCTGG + Intronic
1063283343 10:4655549-4655571 AGAGTGGGAGCAAGGGAGCCAGG + Intergenic
1063362005 10:5466853-5466875 GGAAGGGAAGGAAAGAAGCCAGG + Intergenic
1063900599 10:10728502-10728524 ACAGGGGCAGGAAAGCACCCAGG + Intergenic
1064014468 10:11761830-11761852 AGAGAGGGAGGAAGACAGGCAGG - Intronic
1064283232 10:13969885-13969907 AGAGGTGGAGGCCAGAAGCCAGG + Intronic
1064354669 10:14605884-14605906 AGAGGGGGAGGGAGATAGCCAGG - Intronic
1064414470 10:15136461-15136483 AGAGAGGGAGGAAAGGAGGAAGG + Intronic
1064768380 10:18698108-18698130 ATAGGGGGAAGAAAACAACCTGG - Intergenic
1065319367 10:24494942-24494964 ACTGGGGGTGGAATGCAGCCAGG - Intronic
1067230196 10:44400975-44400997 AAAGGGGGAGGGAAGGAGGCAGG - Intergenic
1067782669 10:49220172-49220194 ACAGGGGAAGGAGAGGAGCCAGG - Intergenic
1067849069 10:49743646-49743668 ACAGGGGCTGGAACGCAGCCTGG - Intronic
1068470832 10:57460835-57460857 AGAGGGGGAACAAAGCAGTGTGG + Intergenic
1068927835 10:62558488-62558510 AGGGAGGGAGGAAAGAAGCAAGG - Intronic
1069234961 10:66059570-66059592 AGATGGGCAGCAAAGCAGACAGG - Intronic
1069535526 10:69250080-69250102 GGAGGCCAAGGAAAGCAGCCTGG + Intronic
1070228267 10:74535249-74535271 AGAGGTGTTGGAAACCAGCCTGG + Intronic
1070789297 10:79180115-79180137 AGAGGGGATGGAAGGGAGCCAGG + Intronic
1070902254 10:80039850-80039872 AGAGGAGGAGGAAGGGAGGCGGG + Intergenic
1071273379 10:84029548-84029570 AGAGGTGGTGGAATCCAGCCAGG - Intergenic
1071503672 10:86220513-86220535 AGAGTGAGAAGAAAGCAGCCTGG + Intronic
1071573299 10:86709670-86709692 AGAGAGGGAGAAAAGCCACCAGG - Intronic
1072426727 10:95336536-95336558 AGGCGGGGAGGAAAGCTGCTCGG - Exonic
1072535636 10:96360538-96360560 AGAGGGCCAGGACAGCTGCCAGG + Intergenic
1072717733 10:97762807-97762829 AGAGGGGGAGGGTGGCACCCAGG - Intergenic
1073094952 10:100973629-100973651 AGAAGGGGAGGAAAGGAGCTGGG - Intronic
1073542355 10:104324336-104324358 AGAGGGGCAGGTGAGCAGACTGG + Intronic
1073592964 10:104773794-104773816 AGAGGTGGAGGAAACCAGCCTGG - Intronic
1073740964 10:106406411-106406433 GGAGGGGGAGGAAAGAAACAGGG + Intergenic
1074006023 10:109424506-109424528 AGAGGGGAAAGAAAGAAGCAAGG + Intergenic
1074094988 10:110304362-110304384 TGGCGGGGAGGAGAGCAGCCTGG - Intronic
1074102593 10:110365263-110365285 AGAGTGTGAGGACAGCCGCCAGG + Intergenic
1074125311 10:110524571-110524593 ACGGGGGCAGGAAAGCAGACTGG - Intergenic
1074609128 10:115004425-115004447 AGGGAGGGAGGGAAGCAGGCAGG - Intergenic
1075344689 10:121673508-121673530 GGTGGGGGAGGAAAGAAGCCAGG - Intergenic
1075413541 10:122246615-122246637 TGAGGGTGAGAAAAGCTGCCCGG + Intronic
1075471956 10:122697647-122697669 AGATGGGGTGGCAAGGAGCCTGG + Intergenic
1075667496 10:124241372-124241394 AGATGAGGAGGAAAGAGGCCTGG + Intergenic
1075710418 10:124527660-124527682 AGAGGGGGAGTCCAGCTGCCCGG + Intronic
1075747982 10:124741520-124741542 AAAAGGGGAGGAGAGCAGGCTGG + Intronic
1076992974 11:285112-285134 AGCGGTGGGGGAAAGCAGCCAGG - Intronic
1077185434 11:1233580-1233602 AGGGGGGCAGCAAAGCAGCCAGG - Intronic
1077462028 11:2715493-2715515 CCAGGGGGAAGAGAGCAGCCAGG + Intronic
1077923194 11:6656124-6656146 AGAGGAGGAGGTGAGCAGCAGGG - Intergenic
1078395284 11:10976045-10976067 AGAGGGGAAGGAAGGCAGAGAGG - Intergenic
1078545302 11:12242577-12242599 AGTGGGTGAGGGAGGCAGCCGGG - Intronic
1079129516 11:17739094-17739116 AGAGGGGGAGGAGGGCGGGCAGG - Intronic
1079302446 11:19290292-19290314 AGAGAGAAAGGACAGCAGCCAGG - Intergenic
1081670277 11:44938702-44938724 GGATGGGGAGGAAAGGAGCCTGG + Intronic
1081859810 11:46326396-46326418 AGGGAGGGAGGAAGGCAGGCAGG + Intergenic
1082837759 11:57664069-57664091 AGGGAGGGAGGAGATCAGCCGGG - Intergenic
1082905128 11:58299701-58299723 AGAGAGGGAGGAAGGGAGGCAGG - Intergenic
1082920890 11:58492634-58492656 AGAGGGAGAGGAAAACAGAGAGG - Intergenic
1083140165 11:60714985-60715007 AGATGGGGAGGACAGGAGCACGG - Intronic
1083162670 11:60864943-60864965 GGAGGGGAAGGAGAGGAGCCAGG - Intergenic
1083293275 11:61701480-61701502 CCTGGAGGAGGAAAGCAGCCGGG + Intronic
1083607726 11:63988767-63988789 AGAGCGGGTGGGAAGCACCCTGG + Intronic
1083664519 11:64267298-64267320 AGACGGGGTGCAAGGCAGCCAGG + Intronic
1084064179 11:66693894-66693916 AGAGGGCAAGGCAAGCAGCAGGG + Intronic
1084227864 11:67728636-67728658 ACAGGGGTCGGAACGCAGCCCGG - Intergenic
1084477054 11:69395003-69395025 AGAGGGGGAGCCAGGCAGCCAGG - Intergenic
1084807365 11:71588229-71588251 ACAGGGGTCGGAACGCAGCCCGG + Intronic
1084844448 11:71888237-71888259 ACAGGGGTGGGAAGGCAGCCCGG + Intronic
1085345513 11:75765904-75765926 AGAGGGGTAGGAAATGAGGCTGG - Intronic
1085410528 11:76287976-76287998 AGAGGGGGAGGAGAACTGGCTGG - Intergenic
1085476757 11:76793985-76794007 AGAGGGGGAGGAGATGGGCCAGG - Intronic
1085698814 11:78728522-78728544 AGAGAGGGAGGGAAGGAGGCGGG - Intronic
1085780182 11:79401178-79401200 AGAGAGGGAGGGAAGGAGGCAGG - Intronic
1086392799 11:86382600-86382622 AGAGGGGGTGGCAAGGAGTCTGG + Intronic
1086415707 11:86587150-86587172 AGAGGAGGAGAAAAGCATCCAGG + Intronic
1087791428 11:102410345-102410367 AGAGGGTGAGAAAAGCAGCCTGG + Intronic
1088426498 11:109710376-109710398 ACAGGGGTATGAGAGCAGCCTGG - Intergenic
1088443692 11:109900825-109900847 AGAGGGAGAGGCAATTAGCCAGG + Intergenic
1089228696 11:116950011-116950033 AGCGGGGGAGGACAGCAGCCTGG + Intronic
1089367218 11:117928287-117928309 AGAGGGCAAGGGAGGCAGCCTGG + Intronic
1089454980 11:118620908-118620930 AGAGGGAGAGGAAAAGAGCAGGG - Intronic
1089489064 11:118870446-118870468 AGTGGGGAAAGAGAGCAGCCAGG - Intergenic
1089606778 11:119645923-119645945 AGAAGGGGAGGACAGAGGCCTGG - Intronic
1089633345 11:119796925-119796947 AGAGGTGGGGGAAGGCAGGCTGG - Intergenic
1089899447 11:121965519-121965541 AGAGGGGCTGGAAACCCGCCAGG + Intergenic
1090536026 11:127642679-127642701 AGAGGGGAAGGAAAGGAGAGAGG + Intergenic
1090592908 11:128291321-128291343 TGAGTGAGAGGAAAGCAGCGGGG - Intergenic
1090799540 11:130161652-130161674 AGAGGAGGAGGAAATGAGCAGGG - Intronic
1091405077 12:203880-203902 AGAGGGCGGGGAGGGCAGCCCGG + Intronic
1091908501 12:4209228-4209250 AGAGGAGCAGGAAATCACCCAGG + Intergenic
1092810365 12:12266782-12266804 AGTGGGGGAGGCGAGGAGCCGGG + Exonic
1092884388 12:12912551-12912573 AGAGTGGGACAAATGCAGCCGGG + Exonic
1094155070 12:27330608-27330630 AGAGGGGGTGGAAAACAACAAGG - Intergenic
1094526241 12:31233202-31233224 TGGGGGTGAGGAAAACAGCCAGG - Intergenic
1095518098 12:43029324-43029346 TGAGGGGGAACAAAGCAGCAGGG + Intergenic
1095792685 12:46185005-46185027 GGGAGGGGAGGAAAGGAGCCTGG - Intronic
1096284102 12:50283355-50283377 AGAGGGTGTGGAGAGAAGCCGGG + Intronic
1096585860 12:52619128-52619150 AGAGGAGCAGGAGAGCTGCCTGG - Intergenic
1096749867 12:53751859-53751881 AGCGGGGGAGGAAAAGAGGCGGG - Intergenic
1097037098 12:56131166-56131188 GGAGGGGGAGTGAAGTAGCCTGG - Intronic
1097166931 12:57091017-57091039 GGAGGGGAAGAAAAGCAGGCAGG + Intronic
1098973152 12:76877046-76877068 AAAGGGGGAGGAACGAAGCCAGG - Intronic
1099160357 12:79233690-79233712 TGAGGGCCTGGAAAGCAGCCAGG - Intronic
1099336499 12:81366069-81366091 AGAGGGGGAAGAAAGAAGGGAGG - Intronic
1099402014 12:82211717-82211739 AGAGAGAGAGGACAGAAGCCTGG - Intergenic
1100040754 12:90314211-90314233 AGAGGGGGAGAACTTCAGCCAGG + Intergenic
1100267372 12:92990411-92990433 AGAAGGGAAGGAAAGAAGCTAGG + Intergenic
1101862461 12:108494170-108494192 AGAGGGGCTGGAAAGCAGGCAGG - Intergenic
1102187010 12:110956962-110956984 AGTGAGGGAAGGAAGCAGCCAGG + Intergenic
1102570827 12:113825993-113826015 AGAGTGGGAGGGAAGCAGAGAGG - Intronic
1102655018 12:114475195-114475217 AGGGAGGGAGGAAAGCAGGAAGG - Intergenic
1102735260 12:115153511-115153533 AGAGAGGGAGGAAAGAGGCTGGG + Intergenic
1103105384 12:118219935-118219957 AGAGAGGGAGGAAAGAAGGAAGG - Intronic
1103479070 12:121239281-121239303 TGAGGGGGAGGAAAGCTGGAAGG - Exonic
1103587005 12:121963492-121963514 AGACGGGGAGGACACCAGCCGGG + Intronic
1103884127 12:124188265-124188287 AGAGGAGGAGGAAACCAAACCGG - Intronic
1104003030 12:124872551-124872573 AGATGGGGAAGAAAGCAGGCAGG + Intronic
1104603204 12:130167547-130167569 AGGGAGGGAGGAAAGAAGCAAGG + Intergenic
1104717710 12:131026978-131027000 TGAGGGAGATGAAAGCAGGCGGG + Intronic
1105008793 12:132740542-132740564 CGAGAGAGAGGAAAGCAGGCAGG + Intronic
1105817043 13:24045810-24045832 AGGAGGTGAGGAAGGCAGCCTGG - Intronic
1105844845 13:24285502-24285524 AGGGAGGGAGGAAGGCAGGCAGG - Intronic
1105928675 13:25032365-25032387 AGAGGGGAAGGAGTGGAGCCAGG - Intergenic
1106753034 13:32794443-32794465 AGAGGGGCAGCAAGGAAGCCTGG - Intergenic
1106905253 13:34401175-34401197 AGAGGCTGAGGAAGGCAGCGGGG + Intergenic
1107078282 13:36346645-36346667 AGAAGGGGAGAAAAGGAGCGAGG + Exonic
1108046427 13:46388247-46388269 AGGGAGGGAGGAAGGCAGGCAGG + Intronic
1108163366 13:47666240-47666262 AGAGAGGCAGGAGGGCAGCCAGG - Intergenic
1108359948 13:49659820-49659842 AGAGAGGGAGGGAAGAAGACAGG + Intergenic
1108385115 13:49892652-49892674 AGAGGTGGAGGAACAAAGCCAGG - Intergenic
1108590504 13:51908544-51908566 AGAGGTGGAGGAACAAAGCCAGG + Intergenic
1108742469 13:53352382-53352404 AAATGGGGGGGAAAGTAGCCAGG - Intergenic
1109127034 13:58530681-58530703 AGAGGTGGAGGAACAAAGCCAGG - Intergenic
1109314307 13:60732231-60732253 AGAAGGTGAGGAAACAAGCCCGG - Intergenic
1110165921 13:72443004-72443026 TTAGGGGGAGGAAAGCATCTTGG + Intergenic
1110261534 13:73490684-73490706 AGAGCGGGTGGAAAGAAACCAGG + Intergenic
1110414612 13:75238265-75238287 AGAGGTGGAGGAATAAAGCCGGG + Intergenic
1110558253 13:76885062-76885084 AGAATGGGAGGGCAGCAGCCAGG + Exonic
1110594356 13:77302417-77302439 AGAGGTGGGGGAAAGTAACCTGG + Intronic
1110692621 13:78449237-78449259 AGGGAGGGAGGAAAGAAGGCAGG - Intergenic
1110889807 13:80684768-80684790 AGAGGGGGAGGAAGGGAGGAAGG - Intergenic
1111384445 13:87505736-87505758 GGAGAGGGAGAAAAGCAGCAGGG + Intergenic
1112098234 13:96158706-96158728 AGAGGTGTAGGAAGACAGCCGGG + Intronic
1112222269 13:97502921-97502943 AGAAGGGGAGGAAACCAACAAGG - Intergenic
1112465702 13:99642729-99642751 AGGGAGGGAGGGAAGCAGGCAGG - Intronic
1112752796 13:102598657-102598679 TGAGTGGGAGGAAAACAGCTGGG + Intronic
1113537495 13:111079698-111079720 GGAAAGGGGGGAAAGCAGCCAGG - Intergenic
1113655629 13:112066731-112066753 GGAGGGGGAGCAAAGCAGGAAGG - Intergenic
1115264711 14:31489063-31489085 AGATGAAGAGGAAAGCAGGCAGG - Intergenic
1115314144 14:32008715-32008737 AGAGAGGGAGGAAAGGAGGGAGG - Intronic
1115354484 14:32432998-32433020 AGAAGGGGAGGAAAGTAGAAGGG + Intronic
1115509533 14:34126138-34126160 TGAGGGGGAGTGAAGCAGCAAGG + Intronic
1116010738 14:39348794-39348816 AGAGGTGGAGGAACAAAGCCAGG - Exonic
1117308316 14:54497846-54497868 AGAGAGGGAGGCCAGAAGCCTGG + Intergenic
1117382806 14:55182066-55182088 ATATGGGGAGGAAAGCACACAGG - Intronic
1117781391 14:59236374-59236396 AGAGGAAGAGGCAAGAAGCCAGG - Intronic
1117992603 14:61449327-61449349 AGAGGGGGAGGAAAGGAGGGAGG - Intronic
1118439230 14:65798148-65798170 AGAGGGGCTAGAGAGCAGCCAGG + Intergenic
1118467770 14:66046353-66046375 AGGGAGGGAGGAAGGCAGGCAGG - Intergenic
1118906490 14:70027398-70027420 AGAGGGGGAGCAGACCAGCCTGG + Intronic
1119045998 14:71319879-71319901 AGAGGAGGAGGGAGGCAGCATGG + Intergenic
1119219216 14:72893029-72893051 AAAGGAGGAGGAAGGCAGGCAGG + Intronic
1119609230 14:76047696-76047718 ACAGAGGGAGGAAGGCAGGCGGG - Intronic
1120346261 14:83294178-83294200 AGAGAGGGAGGAAAGAAGGAAGG - Intergenic
1120622938 14:86788338-86788360 TGAGGGGGAAGAAAGGAGGCTGG + Intergenic
1121020095 14:90574809-90574831 AGAGAGGAAGGCAAGGAGCCAGG - Intronic
1121047835 14:90800888-90800910 AAAGAAGGAGGAAGGCAGCCAGG + Intronic
1121184369 14:91953741-91953763 AGACAGGGAGGGAAGTAGCCAGG - Intergenic
1121256260 14:92532511-92532533 AGAAGGGGAGACAAGGAGCCTGG - Intronic
1121442576 14:93958134-93958156 CGAGGATGAGGAAGGCAGCCAGG - Intronic
1121471803 14:94161296-94161318 AGAGAGAGAGGAAAGATGCCAGG - Intronic
1121638344 14:95468704-95468726 ATATGGGGAGGAAGGGAGCCAGG - Intronic
1121692852 14:95890237-95890259 AGAGAGGAAGGAAAACATCCTGG - Intergenic
1121706774 14:96002249-96002271 AGCAGGGGAGAAATGCAGCCTGG - Intergenic
1121915998 14:97837393-97837415 AGAGAGGGAGGAAAGAAGGAAGG + Intergenic
1122002106 14:98667093-98667115 AGAGAGGGAGGAAAGAAGGGAGG - Intergenic
1122023764 14:98859792-98859814 ACAGAGGGAGGGAACCAGCCAGG + Intergenic
1122087068 14:99315155-99315177 GGAGGTGGAGGAAAGCAGAAGGG + Intergenic
1122424221 14:101596312-101596334 AGTGGTGGAGGGAAGCAGACAGG + Intergenic
1122424228 14:101596346-101596368 AGCGGTGGAGGGAAGCAGACAGG + Intergenic
1122424235 14:101596380-101596402 AGCGGTGGAGGGAAGCAGACAGG + Intergenic
1123060665 14:105592760-105592782 AGAGGAGGAGGGAGGTAGCCTGG + Intergenic
1123085140 14:105713731-105713753 AGAGGAGGAGGGAGGTAGCCTGG + Intergenic
1123703531 15:22933777-22933799 AGGAGGAGAGGAAAGCTGCCTGG - Intronic
1124002636 15:25771670-25771692 AGAGGGGCAGGTAGGCAGCCAGG - Intronic
1124494339 15:30177210-30177232 ACAGGGGCAGGAAAGAAGCCAGG - Intergenic
1124749231 15:32361435-32361457 ACAGGGGCAGGAAAGAAGCCAGG + Intergenic
1124789838 15:32717691-32717713 AGAGCGGGAGGAAATCCCCCCGG - Intergenic
1125394375 15:39231071-39231093 AGAGAGGGAGGAAACCATGCTGG + Intergenic
1126321472 15:47428938-47428960 AGGGAGGGAGGAAAGAAGCAAGG + Intronic
1126775170 15:52094223-52094245 AGATGGGGAGGAGAGGAGCCAGG - Intergenic
1127377968 15:58402361-58402383 AGAGGGAGATGGAAGCAGCTGGG + Intronic
1127623525 15:60757766-60757788 AGAGAGGGAAGAAACCAGCAAGG - Intronic
1127665647 15:61144196-61144218 ACAGAGGAAGGAAAGGAGCCAGG + Intronic
1128083465 15:64870466-64870488 AGAGGAGGAGGAAGGGAGCTGGG - Intronic
1128243050 15:66114648-66114670 AGGGAGGGAGGAAGGCAGGCAGG + Intronic
1128249646 15:66155348-66155370 AGTGGGGCAGGAAAGAGGCCGGG + Intronic
1128331690 15:66760341-66760363 AGAAGGGAAGGAAGGCAGCATGG + Intronic
1128576968 15:68782943-68782965 AGAGGAGGAGGTAAGGAGGCTGG - Exonic
1128691228 15:69726307-69726329 AGAGGGGGTGCACAGCTGCCTGG + Intergenic
1128749796 15:70140735-70140757 CAAGGGGAAGGAAAGCAGCTTGG + Intergenic
1128751995 15:70156415-70156437 AGTAGGGAAGGAAAGGAGCCTGG - Intergenic
1128889171 15:71315517-71315539 AAATGGGAAGGAAAGCACCCAGG + Intronic
1128980040 15:72179374-72179396 AGATGTGGAGGTATGCAGCCAGG + Intronic
1129385483 15:75193959-75193981 AAAGGGGGAAGGAAGCAGGCTGG - Intergenic
1130513175 15:84605719-84605741 CTAGGGGCAGGAGAGCAGCCAGG + Intronic
1130966332 15:88700354-88700376 AGAGGTGTAGGCAAGCAGACAGG - Intergenic
1131298318 15:91172198-91172220 AGAGGGGGAGGAGAAGAGGCTGG - Intronic
1131377760 15:91939659-91939681 AGAGGAGGAGGGAAGAAGCCTGG - Intronic
1132802410 16:1760944-1760966 GGAGGGGGAGCAAAGCAGAGGGG - Intronic
1132833113 16:1939156-1939178 AGAGGGGGCGGAAAGTATGCGGG + Intronic
1133138792 16:3729934-3729956 AGCGGTGGAGGGAAGCAGCCAGG - Intronic
1133367056 16:5218362-5218384 ACAGTAGGAGGAAAGAAGCCAGG - Intergenic
1133390207 16:5404036-5404058 AGAATGGGTGGAAAGCAGCTTGG + Intergenic
1133531990 16:6663805-6663827 AGATGGGGTGGAGAGCATCCTGG + Intronic
1133586023 16:7196351-7196373 AGAGGGGGAGTGAAGCAGGGTGG - Intronic
1133924559 16:10182483-10182505 AGAGGGGGAGGGAAGGACGCGGG + Intronic
1134165380 16:11925491-11925513 AGAGAGGGAGGCAGGCAGGCAGG + Intergenic
1134231931 16:12436315-12436337 AGAGGGGAAGGAACGAAGACAGG + Intronic
1134231943 16:12436449-12436471 TGGCAGGGAGGAAAGCAGCCAGG - Intronic
1134489923 16:14688951-14688973 AGAGAGGGAGGCAGGCAGGCAGG - Intronic
1134495304 16:14728068-14728090 AGAGAGGGAGGCAGGCAGGCAGG - Intronic
1134500692 16:14767191-14767213 AGAGAGGGAGGCAGGCAGGCAGG - Intronic
1134527230 16:14953798-14953820 AGAGAGGGAGGCAGGCAGGCAGG - Intergenic
1134545170 16:15102541-15102563 AGAGAGGGAGGCAGGCAGGCAGG + Intronic
1134579890 16:15361858-15361880 AGAGAGGGAGGCAGGCAGGCAGG + Intergenic
1134714818 16:16352340-16352362 AGAGAGGGAGGCAGGCAGGCAGG - Intergenic
1134722695 16:16395702-16395724 AGAGAGGGAGGCAGGCAGGCAGG - Intergenic
1134944733 16:18316169-18316191 AGAGAGGGAGGCAGGCAGGCAGG + Intergenic
1134951997 16:18356319-18356341 AGAGAGGGAGGCAGGCAGGCAGG + Intergenic
1135310339 16:21400387-21400409 AGAGAGGGAGGCAGGCAGGCAGG + Intergenic
1135606576 16:23831166-23831188 AGAGGGGAAGGAAGGCAGGAAGG - Intergenic
1136172395 16:28496826-28496848 AGAGGAGCAGGAGAGGAGCCTGG + Exonic
1136291259 16:29272905-29272927 AGTGGGGGAGCAAAGGAGCTGGG + Intergenic
1136295027 16:29296675-29296697 AGAGGCAGAGGAAAGCAGCCTGG - Intergenic
1137433081 16:48434076-48434098 AGACAGGGAGGAAAGAAACCTGG - Intronic
1137517674 16:49162359-49162381 AGTGGGGCAGGAAATCAGCCAGG - Intergenic
1137788443 16:51155010-51155032 AGAGGTTGAGCAAAGAAGCCTGG - Intergenic
1137964776 16:52919987-52920009 AGTGGGGGAGGGAAGCATGCTGG - Intergenic
1138399037 16:56730594-56730616 CGAGGGGTAGGCAAGCAGGCAGG - Intronic
1139135678 16:64201825-64201847 AAAGGAGGGGGAAAACAGCCTGG + Intergenic
1139303124 16:65962028-65962050 AGAGAGGGAGGAAAGGAGGGAGG + Intergenic
1139312639 16:66040332-66040354 AATGGGGGAGGAAAGGATCCTGG - Intergenic
1139335313 16:66227079-66227101 AGAGGTAGAGGAAAGAAGGCAGG - Intergenic
1139632073 16:68236915-68236937 AGAAAGGGACGAAAGCAGGCAGG - Intronic
1139860510 16:70016788-70016810 GCAGGGGCAGGAAAGCAGACGGG + Intergenic
1140012772 16:71152834-71152856 AGACGGGGAGGAAAGGAGACAGG + Intronic
1140134927 16:72197600-72197622 AGTGGAGGAGGAGGGCAGCCGGG - Intergenic
1140189145 16:72800026-72800048 GAAGAGGCAGGAAAGCAGCCTGG - Exonic
1141141680 16:81500459-81500481 AAAGGGGGAGGAAAGAAGGAGGG - Intronic
1141466905 16:84212263-84212285 ACAGGGCGAGGAAGGCAGTCAGG - Intergenic
1141690555 16:85594090-85594112 AGGGAGGGAGGAAAGGGGCCTGG + Intergenic
1142097131 16:88246371-88246393 AGTGGGGGAGCAAAGGAGCTGGG + Intergenic
1142100927 16:88270684-88270706 AGAGGCAGAGGAAAGCAGCCTGG - Intergenic
1142125725 16:88409378-88409400 AAAGCGGGAGGGCAGCAGCCAGG + Intergenic
1142300380 16:89254391-89254413 AGAGGGGCAGCAAACCAGCATGG - Intergenic
1142599716 17:1047734-1047756 AGTGGGGGAGGGAGGAAGCCAGG - Intronic
1142716043 17:1747508-1747530 AGAGGAGGAGGAGCGCACCCTGG - Exonic
1143050385 17:4120530-4120552 AGCTGGGGAAGAAAGAAGCCAGG + Intronic
1143562580 17:7704592-7704614 AGAGTGGGAGGTGCGCAGCCTGG + Intergenic
1143724880 17:8837960-8837982 AGATGGGGTGGAAGGCAGCCAGG + Intronic
1145134164 17:20387011-20387033 TGATGGGGAGGACAGCAGGCCGG + Intergenic
1145841559 17:27999485-27999507 TGAGGGGCAGGAAAGCCCCCTGG + Intergenic
1145960497 17:28884135-28884157 AGGAGGAGAGGACAGCAGCCAGG - Intronic
1146085918 17:29829511-29829533 AGAGAGGGAAGAAGGGAGCCTGG + Intronic
1146653400 17:34621085-34621107 ACAGGGGGAGGAAGACAGGCTGG - Intronic
1146684029 17:34828314-34828336 GGAAGTGGAGGCAAGCAGCCTGG - Intergenic
1147002923 17:37377844-37377866 AGAGGGGGAGGAGGGGAACCGGG - Intronic
1147196276 17:38768935-38768957 TGAGGGGCAGGAAAGCGGCTGGG - Exonic
1147215660 17:38897690-38897712 AGGAGGGGAGGAAAGCAGCGGGG - Intronic
1147439082 17:40436505-40436527 AAAGGGGGAGGCATGCAGCTGGG + Intergenic
1147455873 17:40537763-40537785 AAAGGTGGAGGAAAGAAGTCGGG + Intergenic
1148454606 17:47804415-47804437 AGAGGGAGAGGAAGGTAGGCAGG - Intergenic
1148563420 17:48619388-48619410 AGAGGGAGAAGAGAGAAGCCGGG - Intronic
1148697683 17:49570862-49570884 AGACGGGGAGGACAGGAGCAGGG - Intergenic
1148855090 17:50574603-50574625 AGAGGGGGAAGGAAGCAGACAGG + Intronic
1149454814 17:56779388-56779410 AGTGGGGGAGGCAGGCTGCCAGG + Intergenic
1149661870 17:58338308-58338330 GGAGGGGGAGGTGAGAAGCCTGG + Intergenic
1150466858 17:65400946-65400968 AGAGAGGGAGGAAGGGAGGCAGG - Intergenic
1150855938 17:68752886-68752908 AGAGGGGGAGGAATGGAGACGGG - Intergenic
1150888063 17:69110575-69110597 AGAGGGAAGGGAAGGCAGCCAGG - Intronic
1150947765 17:69765822-69765844 AGAGGGGGAGGAAAGGCGTAAGG - Intergenic
1151386703 17:73759477-73759499 TGAGTGGGAGGAAAGACGCCCGG + Intergenic
1151440586 17:74126420-74126442 AGAGAGGGAGGAAATGGGCCAGG - Intergenic
1151535141 17:74735092-74735114 AGAGGGGAAGGAAGGAAGGCAGG + Intronic
1151734591 17:75931201-75931223 GGAGGTGGAGGGAAACAGCCAGG + Intronic
1151882524 17:76903950-76903972 AGAGGGAGAGGGAGACAGCCAGG + Intronic
1152136196 17:78505151-78505173 AGAGGGAGAGGAGAGGAGCAGGG + Intronic
1152626886 17:81391909-81391931 AGAGGGGGAGGAAAGGAGAGGGG - Intergenic
1152671305 17:81608896-81608918 ACAGGGGGAGGCCAGCAGCATGG + Intronic
1152722382 17:81929307-81929329 TGAGGGGCAGCAAAGGAGCCTGG - Intergenic
1153148134 18:2056844-2056866 AGAGGGGCAGGTAGGCAGTCAGG + Intergenic
1153302493 18:3603435-3603457 AGGGAGTGAGAAAAGCAGCCCGG + Intronic
1153314933 18:3712219-3712241 AGAAGAGGTGGAAAACAGCCTGG + Intronic
1153904662 18:9650490-9650512 AGAGGAGGAGGAAGGGAGACTGG + Intergenic
1154515322 18:15157901-15157923 AGAGGGAGAGGAAGGCAGGGAGG - Intergenic
1155081604 18:22415818-22415840 AGAGGTGGAGGAACAAAGCCAGG + Exonic
1156206135 18:34887837-34887859 AGAGGAGGAAGACAGCAGCCTGG + Intronic
1156470319 18:37373714-37373736 GGAGGGGCTGGAAAGCAGCCTGG + Intronic
1156802214 18:41129891-41129913 ACAAGGGAAGGAAACCAGCCAGG + Intergenic
1156970666 18:43150936-43150958 AGGGAGGGAGGAAAGCAGGTTGG + Intergenic
1157400616 18:47383496-47383518 AGAGAAGGAGGAAAGCAAACAGG - Intergenic
1158225461 18:55196719-55196741 AGAAGGGGAGAAAAGCAGTTTGG + Intergenic
1159500336 18:69261091-69261113 AGAGGGGGAGGAAGGAAGGAAGG - Intergenic
1159549551 18:69880192-69880214 AGCGGGGGAGGAAGGCAGGCAGG + Intronic
1160194247 18:76739308-76739330 AGGGAGGAAGGAAAGCAGCGAGG - Intergenic
1160208568 18:76857694-76857716 AGAAGAGCAGGAAGGCAGCCCGG - Intronic
1160291505 18:77598722-77598744 AGAGGGGAATGATGGCAGCCAGG - Intergenic
1160383391 18:78477996-78478018 AGAGGGAGAGGGACGCAGCTGGG - Intergenic
1160533790 18:79580605-79580627 AGATGGGGAGGAATGAAGCTGGG - Intergenic
1160836309 19:1126407-1126429 AGGGCGTGAGGAAAGAAGCCAGG - Intronic
1160914942 19:1491828-1491850 AGAGGAGGAGGAAAGGAGAAGGG - Intronic
1160988576 19:1851515-1851537 AGAGGGGCAGAAAACCAGGCAGG + Intergenic
1161106053 19:2444649-2444671 AGAGAGAGAGGATGGCAGCCTGG + Intronic
1161432159 19:4238930-4238952 AGTGGGCAAGGAAGGCAGCCAGG + Intergenic
1161596659 19:5154189-5154211 AGAGGGGGAGGAGGGGAGGCAGG + Intergenic
1161931689 19:7344887-7344909 GGAGGGGAAGGAAGGGAGCCAGG + Intergenic
1162015099 19:7841369-7841391 AGAGAGGCAGGAAGGAAGCCAGG + Intronic
1162515074 19:11142793-11142815 AGTGGGAGAGGAACGCGGCCTGG - Intronic
1162699375 19:12502169-12502191 AGAGAGTAAGGAAAGGAGCCTGG - Intronic
1162722497 19:12670639-12670661 GGAGGGGGAGGGCAGCACCCTGG - Exonic
1163004627 19:14389394-14389416 AGAGGGAGAGGAAAGGAGGCAGG + Intronic
1164466941 19:28495105-28495127 AGAAGGGGAGGGAAGGAGGCAGG + Intergenic
1164508092 19:28875659-28875681 AGAGGAGGAAGACAGCAGGCTGG + Intergenic
1164808622 19:31138579-31138601 GGAGGGGTGGGAAAGAAGCCAGG - Intergenic
1165212145 19:34244374-34244396 AAAAGAGGAGGAAAGCAGGCTGG - Intergenic
1165737241 19:38184471-38184493 AAAGGGGGAGGACAGGGGCCGGG - Intronic
1166234251 19:41444104-41444126 GGAGGAGGAGGAGAGCAGCAAGG + Exonic
1166330511 19:42075751-42075773 GGAGAGGGAGGAAAAGAGCCTGG - Intronic
1166573122 19:43811756-43811778 AGGGAGGGAGGAAGGCAGGCAGG + Intronic
1166767845 19:45263088-45263110 AGAGGGGGAGGAAAGGAGGAGGG - Intronic
1166796374 19:45428703-45428725 ACGGGGGGCGGAGAGCAGCCCGG + Intronic
1167130688 19:47583496-47583518 AGGAGGGGAGGGAAGAAGCCAGG - Intergenic
1167195137 19:48023259-48023281 AGAGAGGGAGGAAAGAAGAAAGG + Intronic
1167436506 19:49481510-49481532 TGAGAGGGAGGAAAGGAGCTGGG + Intronic
1167790732 19:51677980-51678002 AGGGTGGGAGGAAAGAAGTCAGG + Intergenic
1167799241 19:51729627-51729649 AGAGGGGGAGGAGAGAAGTTGGG + Intergenic
1167887136 19:52509555-52509577 AAAGGGGGTGGAGACCAGCCTGG + Intronic
1167991623 19:53365681-53365703 AGCGGGGAAGGACAGAAGCCAGG - Exonic
1168160627 19:54508259-54508281 ACAGAGAGAGGACAGCAGCCGGG - Intronic
925230234 2:2226498-2226520 AGAGAAGGAGAAAAGCAGCCTGG - Intronic
925468751 2:4135982-4136004 AGAACAGGAGGAACGCAGCCTGG - Intergenic
926311144 2:11677208-11677230 AGAGCAGGAGAAAAGCATCCCGG + Intergenic
927101250 2:19789315-19789337 AGTGGGGTAGGAAGGCAGGCTGG + Intergenic
927183955 2:20468729-20468751 ACAGGGGGAGGAAGGGAGCCTGG + Intergenic
927665948 2:25032990-25033012 AGAGGGAGAGGGAAGAAGCAAGG - Intergenic
928131477 2:28654760-28654782 AGAAGAGGGAGAAAGCAGCCGGG + Intergenic
928231782 2:29504915-29504937 AGAGGGGGAGGCAAGGAGCCTGG + Intronic
928510121 2:31995007-31995029 AGGGAGGGAGGAAGGCAGGCAGG + Intronic
929553603 2:42909760-42909782 AGAAGGTGAGGAAAGAAGTCTGG + Intergenic
929591415 2:43149593-43149615 AGATGGGAGGGAAAGCAGACAGG - Intergenic
929788145 2:45006491-45006513 AGTGCGGGAGCAAAGCAGCGGGG + Intronic
931256842 2:60581633-60581655 GGAGGTGGAGGAAAGCTTCCTGG + Intergenic
931976317 2:67647510-67647532 AGAGGGGTAAGAGAGAAGCCTGG - Intergenic
932265618 2:70364968-70364990 AGAGGTGGAGTCCAGCAGCCAGG - Intergenic
932354848 2:71060206-71060228 TGAGGGGAAGGAAAGCTGCCTGG + Intergenic
932396859 2:71454507-71454529 AAAGGGCCAGGAAAGCAGCCAGG - Intronic
932400639 2:71478895-71478917 AGAGGAGGAGGGAAGCAGAGAGG - Intronic
932599935 2:73116723-73116745 GGAGGGGAACGAAACCAGCCAGG + Intronic
932606406 2:73168638-73168660 AGAGAGGGAGGAAAGAAGGAAGG + Intergenic
933307511 2:80620185-80620207 AGGGTGGGATGAAAGCATCCTGG + Intronic
933343434 2:81051277-81051299 AGTGTGGGAGGAAATCAGCATGG + Intergenic
933512443 2:83258166-83258188 CCAGGGGCAGGAAAACAGCCAGG + Intergenic
933698775 2:85239362-85239384 TGAGGGGGAGGGATGCTGCCTGG - Intronic
933721842 2:85401968-85401990 AGAGAGGGTTGACAGCAGCCTGG + Intronic
933926020 2:87091793-87091815 AGAGAGGGAGGAAAGAAGGAAGG - Intergenic
934514055 2:94973690-94973712 AAAGAGGGAGGAAAGGAGGCTGG + Intergenic
934515304 2:94982421-94982443 AGAAAGGCAGTAAAGCAGCCAGG - Intergenic
934521664 2:95023873-95023895 AGAGGATGAGGAAGGCAGCCCGG - Intergenic
934522994 2:95031560-95031582 AGAGGCTGGGGCAAGCAGCCAGG + Intronic
934528408 2:95068007-95068029 AGATTGGGAACAAAGCAGCCAGG - Intergenic
934728723 2:96642570-96642592 AAAAGGGGGTGAAAGCAGCCAGG + Intronic
934955413 2:98613706-98613728 AGAAGGGGACCAAATCAGCCTGG + Intronic
935162249 2:100539281-100539303 ATAGGAGGTGGAAAACAGCCTGG - Intergenic
935208242 2:100915247-100915269 CAAGGGGGAAGAAAGCAGCAGGG - Intronic
935456068 2:103268983-103269005 AGTGAGGAAAGAAAGCAGCCTGG + Intergenic
935874781 2:107494699-107494721 AGAAGGGGAGGAAAGAAGAGAGG + Intergenic
936235155 2:110736009-110736031 AAAGGGAGAAGGAAGCAGCCAGG - Intronic
936542776 2:113365214-113365236 AGAGAGGGAAGAAAGAAGCAGGG + Intergenic
936772612 2:115932947-115932969 TGAGGAGTTGGAAAGCAGCCTGG + Intergenic
937027471 2:118711365-118711387 AGAGGGAGACAAAAGCAGCTTGG - Intergenic
937029529 2:118726607-118726629 AGAGGGGAAGGAAAGAAGGAAGG + Intergenic
938200258 2:129366970-129366992 AGAGGGGAAGGAAAGGAGGCAGG - Intergenic
938818897 2:134933457-134933479 AGAGAGGGGAGACAGCAGCCAGG + Intronic
939179307 2:138785304-138785326 AGAGGGGAAGGGAGGCAGGCAGG + Intergenic
940159553 2:150696844-150696866 AGGGAGGGAGGAAAGAAGGCAGG + Intergenic
940506513 2:154561185-154561207 AGGGAGGGAGGCAAGCAGGCAGG - Intergenic
940702915 2:157068871-157068893 AGAGAGGGAGGAAAGAAGGAAGG - Intergenic
940815573 2:158293933-158293955 AGAGGGGAAGGAAGGCAGGAAGG - Intronic
940872047 2:158868389-158868411 ACAGGGGTCGGAACGCAGCCCGG + Intergenic
941062133 2:160859193-160859215 AGTGGGGGAGGAAAGGAGGTAGG - Intergenic
941436808 2:165482709-165482731 AGAGGTGGAAGAAACCAGCCTGG - Intronic
941615498 2:167713981-167714003 AGAGGTGGAGGAATAAAGCCGGG + Intergenic
941709247 2:168694399-168694421 AGAGGGACAGGAAGGCTGCCAGG - Intronic
941951448 2:171160680-171160702 AGAGGAGGAGGAAAGGAGCGCGG + Exonic
942231790 2:173867049-173867071 TGAGGGGCTGGAAAGGAGCCAGG - Intergenic
942342325 2:174961228-174961250 AGGGAGGGAGGAAGGCAGGCAGG + Intronic
942611163 2:177743994-177744016 AGGAGGGGAGGAAAGCCCCCAGG - Intronic
943341809 2:186691410-186691432 AGAAGGAAAGGAATGCAGCCAGG - Intergenic
943766708 2:191670741-191670763 AGAAGGGGAGGGAGGGAGCCAGG - Intergenic
944392205 2:199229064-199229086 ACAGGGTGAGGACAGCAGCTAGG + Intergenic
944633569 2:201652833-201652855 GGAGGGAGAGGAAAGCAGGAAGG + Intronic
944964968 2:204920794-204920816 AAAGGGGGAAGAAAGGAGCAGGG - Intronic
946095428 2:217270420-217270442 GGATGGGGAGGAAGGCAGCTTGG - Intergenic
946135378 2:217642380-217642402 GGAAGGGGAGGAAAGGAGACTGG + Intronic
946226400 2:218266215-218266237 AGAGGGAGAGGAAAGAAGAGTGG + Intronic
946305871 2:218856719-218856741 GGAGTGGGAAGACAGCAGCCCGG - Intergenic
946322362 2:218961285-218961307 AGAGAGAGAGGAATGCAGACAGG - Exonic
946501856 2:220257387-220257409 GGAGGGGGAGGAAAGAAGAAAGG + Intergenic
947734659 2:232448343-232448365 AGAGGGGGAGGAGTGCAGGCTGG - Intergenic
947765021 2:232632595-232632617 AGAGGGGGAGGAAAAAAGAAAGG - Intronic
948796555 2:240405812-240405834 AGCTGTGGTGGAAAGCAGCCTGG - Intergenic
948908783 2:240992711-240992733 AGGGGTGGAGGACAGCAGGCAGG + Intronic
948995452 2:241576079-241576101 GGAGGGGGAGGAGAGCTGGCAGG - Intergenic
1168838168 20:891574-891596 AGAGGGCAAGGGAAGGAGCCAGG - Intronic
1168887675 20:1271126-1271148 GGAGTGGCTGGAAAGCAGCCTGG + Intronic
1169100448 20:2943332-2943354 AGTGGGGGAGGCTAGCAGGCTGG + Intronic
1169122535 20:3105964-3105986 AGCGGGGGAGGAAGGCAGGTGGG + Intergenic
1169431162 20:5537684-5537706 AGAGAGGGAGGAAAGAAGCAAGG + Intergenic
1170148737 20:13205793-13205815 AGAGTGAGAGGGAAGGAGCCAGG + Intergenic
1170321309 20:15101427-15101449 AAAGGGAGAGGAAAGTAGTCTGG - Intronic
1170560283 20:17551305-17551327 AGAGTGGGAGGAAGGCAGAGAGG + Intronic
1170594808 20:17797150-17797172 AGAGGAATAGAAAAGCAGCCTGG - Intergenic
1170968441 20:21097045-21097067 AGAGGGAGAGGAAAGAACCACGG + Intergenic
1171030005 20:21668851-21668873 AGAAGGGGAGGGAAGGAGGCAGG + Intergenic
1171185587 20:23121908-23121930 AGAGGGGGAGGGTGGTAGCCTGG + Intergenic
1171970171 20:31559565-31559587 AGAGTGGCAGGGAAGCAGCAGGG - Intronic
1172624590 20:36339991-36340013 AGCGGGGAAGGAGAGGAGCCTGG + Intronic
1173168139 20:40700561-40700583 AGTGGGGCAGGGAAGCAGCAAGG + Intergenic
1173678872 20:44862000-44862022 TGAGGGGGAGGAAAGGAGGGGGG + Intergenic
1173735502 20:45358540-45358562 AGAGGGGGAGGAAGGGAGAGAGG + Intergenic
1173753054 20:45491851-45491873 AGAGGGGGAAGAGACCAGTCTGG - Intergenic
1175120129 20:56710726-56710748 AGAGGGAGAGGAAGGAAGACAGG - Intergenic
1175227653 20:57454118-57454140 AGGGAGGGAGGAAGGCAGGCAGG + Intergenic
1175300337 20:57938357-57938379 CGTGGGAGAGGAAACCAGCCAGG + Intergenic
1175718252 20:61269694-61269716 AGAGGAGGAGGAGAGCAGGAGGG - Intronic
1175851606 20:62096993-62097015 AGAGGGGGAGGACAGGAGCCAGG + Intergenic
1176047671 20:63101166-63101188 AGAGAGGGAGGGAGGCAGCCTGG + Intergenic
1176297180 21:5080354-5080376 AGATGGGGAGAGAAGCAGCTGGG - Intergenic
1176306306 21:5125204-5125226 AGAGGGGAAGGTAAGAAGCCAGG + Intronic
1176366350 21:6035224-6035246 CGAGGGGGTGGGCAGCAGCCAGG - Intergenic
1177144969 21:17397706-17397728 AGAGGGGGAGGAATGAAGGAAGG + Intergenic
1177471739 21:21568355-21568377 ACAGCGTGAGGAAAGCAGCAAGG + Intergenic
1177652021 21:23969332-23969354 AGAGGCCCAGAAAAGCAGCCTGG - Intergenic
1177896888 21:26863728-26863750 AGAGAGGAAGGAAAGAAGCGAGG - Intergenic
1178808567 21:35860103-35860125 AGAGAGGGAGGAAAGAAGGAAGG + Intronic
1178808573 21:35860127-35860149 AGAGAGGGAGGAAAGAAGGAGGG + Intronic
1178830011 21:36048094-36048116 AGGGAGGGAGGAAGGCAGGCAGG + Intronic
1178865117 21:36320481-36320503 AGAGGCGACGGAACGCAGCCCGG - Intronic
1179133534 21:38660441-38660463 GGACGGGGAGGAAGGCAGCGGGG - Intronic
1179353470 21:40635471-40635493 AGAGAGGGAGGCAGGCAGTCTGG + Intronic
1179658365 21:42859665-42859687 AGAGGAGGACAGAAGCAGCCCGG + Exonic
1179757167 21:43503321-43503343 CGAGGGGGTGGGCAGCAGCCAGG + Intergenic
1179818523 21:43923102-43923124 AGAGGGGATGGAATCCAGCCAGG + Intronic
1179850752 21:44136826-44136848 AGAGGGGAAGGTAAGAAGCCAGG - Intronic
1180092142 21:45538648-45538670 TGAGGGGGCTGAGAGCAGCCAGG + Intronic
1180627522 22:17204040-17204062 ACAGAGGGAGGACAGGAGCCAGG - Intronic
1180832648 22:18913791-18913813 AGAGGGGAGGGAAAGCAGGTGGG - Intronic
1180835577 22:18927982-18928004 AGAAGAGGAAGAAAGCACCCTGG + Intronic
1180959890 22:19757736-19757758 AGAGAGGAAGGAAAGGGGCCTGG + Intronic
1181469273 22:23127907-23127929 AGAGGAGGAGGGAGGCAGCAAGG - Intronic
1181837148 22:25620166-25620188 AAATGGGGCGGAAACCAGCCAGG + Intronic
1182333673 22:29569106-29569128 AGAGGGAGTGGAGAACAGCCAGG + Intronic
1182623115 22:31628622-31628644 AGAGGTAGAGGAAGGCAGCCAGG - Intronic
1183055067 22:35300115-35300137 AGAGTGGGAGGAAAGCTGGGCGG - Intronic
1183178854 22:36245086-36245108 AGATGGGGAGGAAATAGGCCTGG - Intergenic
1183593934 22:38798364-38798386 AGAGGGGCAAGACTGCAGCCAGG - Intergenic
1183598309 22:38825323-38825345 AGAGGGGAAGTAATGCACCCTGG - Intronic
1183704989 22:39470672-39470694 AGAGGGGCAGGAAAGCCTGCAGG - Intronic
1183848230 22:40561328-40561350 AGAAGATGAGGAAAACAGCCAGG + Intronic
1183932872 22:41246178-41246200 AGAGGGGAAGGACAGCACGCGGG + Exonic
1184411049 22:44326704-44326726 GGAGGGGAAGGAGAGCAGGCTGG + Intergenic
1184551936 22:45209222-45209244 GGAGGGGGCGGGAAGTAGCCAGG + Intronic
1184655721 22:45941126-45941148 AGAGGAGGTGAAAAGCTGCCAGG + Intronic
1184945159 22:47797408-47797430 GCAGGGAGAGGAGAGCAGCCAGG + Intergenic
1184991156 22:48170852-48170874 AGAGAGGGATGATAGAAGCCTGG - Intergenic
1185015281 22:48339252-48339274 AGAGAGGCAGGAAAGCAGAGAGG + Intergenic
1185029213 22:48432779-48432801 AGAGAGGGAGGAAAAGGGCCTGG - Intergenic
1185052180 22:48559686-48559708 TGAGGAGGAGGAAGGAAGCCAGG + Intronic
1185136907 22:49078541-49078563 TGAAGGGGAGGTACGCAGCCCGG + Intergenic
1185422025 22:50740066-50740088 TGAGGAGGATGAAAGCAGCCTGG - Intronic
1203282733 22_KI270734v1_random:139096-139118 AGAGGGGAGGGAAAGCAGGTGGG - Intergenic
1203285665 22_KI270734v1_random:153281-153303 AGAAGAGGAAGAAAGCACCCTGG + Intergenic
950224624 3:11223617-11223639 AGAGGGGGAGTCAAGTAGACAGG + Intronic
950352978 3:12375265-12375287 AGAGAGGAAAGAAAGCAGCATGG + Intronic
950414099 3:12858526-12858548 AGAGGGGGTGGATGGCAGCAAGG - Intronic
950435899 3:12979949-12979971 TGAGGTGGGGGAAGGCAGCCTGG + Intronic
951118337 3:18892095-18892117 CGAGGGAGAGAGAAGCAGCCGGG - Intergenic
951403931 3:22270386-22270408 AGAGGAGGAGTAAAACAGACAGG - Intronic
952534553 3:34296058-34296080 AGAAGGGGAGGGAAGGAGCCAGG + Intergenic
953004095 3:38961391-38961413 GTAGGGGGAGAAAAGCAACCAGG - Intergenic
953094023 3:39757242-39757264 TGAGAGTGAGGAAAGCAGGCAGG + Intergenic
953155026 3:40361915-40361937 AGAGGAGGAGTAAGGCAGACAGG - Intergenic
953399575 3:42600954-42600976 AGAGGGGGAGAAAAGCGGTCAGG - Intronic
953463139 3:43097299-43097321 AGAATGGCGGGAAAGCAGCCTGG + Intronic
953789857 3:45939037-45939059 AGGGGAGGAGGAAAGCCGCGTGG - Intronic
953828038 3:46271094-46271116 GGAGGAGGAGTAAAGCAGCCAGG - Intergenic
954445113 3:50542233-50542255 AGAGGGAGAGAAGAGGAGCCAGG - Intergenic
954461641 3:50630175-50630197 AGAAGGGAAGGGAAGGAGCCAGG + Intronic
954463756 3:50642466-50642488 AGAGGCTGAGAAAAGCAGTCTGG - Intronic
954476256 3:50749025-50749047 AGGGAGGGAGGAAAGAAGGCAGG - Intronic
954743791 3:52775148-52775170 GGAGGGAGAGAAAAGCAGACGGG - Intergenic
954797254 3:53167950-53167972 TGAGGGGGAGAAGAGCAGGCAGG - Intronic
954930991 3:54281124-54281146 AGAGGAGGAGGACAGCACCATGG + Intronic
954948482 3:54447740-54447762 AGTGGGGGAAGAAAGCTGCAAGG + Intronic
955443040 3:58977743-58977765 AAAGTGGGAGGAAAGGAGTCAGG + Intronic
955830487 3:62996402-62996424 AGGGAGGGAGGAAAGAAGGCAGG + Intergenic
955831039 3:63004565-63004587 AGAGGAGAAGAGAAGCAGCCTGG - Intergenic
956059980 3:65339601-65339623 GAAGGGGCTGGAAAGCAGCCAGG + Intergenic
956694631 3:71907954-71907976 AGAGGGGCTGGTCAGCAGCCAGG + Intergenic
956745205 3:72305650-72305672 AGACCTGGAGGAAGGCAGCCAGG + Intergenic
957044544 3:75363702-75363724 ACAGGGGTCGGAACGCAGCCCGG - Intergenic
957170886 3:76735436-76735458 AGAGGGGGAGGAAGGCAGCGGGG + Intronic
957780796 3:84815426-84815448 AGAGGGTAAACAAAGCAGCCAGG - Intergenic
957878018 3:86174475-86174497 AGAAGGGGAGGGAAGGAGACAGG + Intergenic
959120885 3:102230557-102230579 AGAAGGGAAGGAAAGGAGCCAGG + Intronic
959185252 3:103038643-103038665 AGAGGGGGAGGGAAGGAGGGAGG + Intergenic
959365362 3:105451312-105451334 AGAGAGGGAGGAAAGGAGGGAGG + Intronic
959934122 3:112012211-112012233 AGGGAGGGAGGGAAGCAGCCAGG - Intronic
960482091 3:118204367-118204389 AGAGAGGGAGGAAAGGAGGGAGG - Intergenic
960632326 3:119744526-119744548 AGAGGGGGAACAAGGCGGCCAGG + Intronic
961146400 3:124597542-124597564 ATAGTGGGAGCAAAGCAGCAGGG + Intronic
961217046 3:125167571-125167593 AGACAGGCAGGAAGGCAGCCTGG + Intronic
961261075 3:125602347-125602369 ACACAGGGAGGAATGCAGCCAGG + Intergenic
961272108 3:125697059-125697081 ACAGGGGTTGGAAGGCAGCCCGG + Intergenic
961488438 3:127233823-127233845 GGAGAGGGAGGAGAGCAGCCTGG + Intergenic
961780361 3:129317120-129317142 AGAGGGGGAGGGGTGCACCCAGG - Intergenic
961876540 3:130027739-130027761 ACAGGGGTCAGAAAGCAGCCCGG - Intergenic
961902202 3:130224053-130224075 AGTGTGGGAGGAAAGGCGCCGGG - Intergenic
962345737 3:134618006-134618028 GTAGGGGGTGGGAAGCAGCCTGG + Intronic
962581351 3:136800701-136800723 AGAGAGGGAGGAGAGCTTCCAGG + Intergenic
962744465 3:138387339-138387361 AGAGATGGAGGACAGAAGCCTGG - Intronic
963179219 3:142336488-142336510 AGAGGCTGAGGAAAGAAGCAGGG + Intronic
963618867 3:147578736-147578758 AGAGGGGGATGAAAACTGCCTGG - Intergenic
963831740 3:150016106-150016128 AAAGGGTGGGGAAAGGAGCCAGG + Intronic
963916338 3:150862009-150862031 AGAGGGCTAGGAAGCCAGCCAGG - Intergenic
963966979 3:151382907-151382929 AGACAGGAAGGAAAGCAGCAAGG - Intronic
964432421 3:156621268-156621290 ACAGGGTGAGGACAGCAGCTAGG - Intergenic
964489785 3:157223638-157223660 AGAGGGTGAGGAAAACATCAAGG - Intergenic
964763139 3:160153315-160153337 ACAGGGAGGGGGAAGCAGCCAGG - Intergenic
965080551 3:164025653-164025675 AGAGGGGGAGGGAAGGAGAGAGG + Intergenic
966734708 3:183179608-183179630 GGAGAGGGGAGAAAGCAGCCAGG - Exonic
966959142 3:184915994-184916016 AGAGAGGGAGGAAAGGAGGGAGG - Intronic
966989043 3:185210091-185210113 AGCGGAGGAGGAAGGCAGGCTGG + Intronic
967186557 3:186949256-186949278 AGAGAGGGAAGAAGGCAGCTAGG + Intronic
967541709 3:190675875-190675897 AGAGGGGGAGGAAGGAAGGAAGG - Intergenic
967836488 3:193968601-193968623 AGAGGAGGAGGGGAGCTGCCAGG + Intergenic
968022601 3:195407041-195407063 AGAGAGGAAGGAAGGCAGACAGG + Intronic
968083572 3:195863798-195863820 AGACTGGGAGGAAACCAGGCTGG - Exonic
968663668 4:1809528-1809550 AGAGAGGGAGGATAGCAGAAGGG - Intergenic
968849626 4:3070019-3070041 AGAGGGGGTGCACACCAGCCTGG - Intergenic
968988803 4:3894943-3894965 ACAGGGGTCGGAACGCAGCCCGG - Intergenic
969025399 4:4168534-4168556 ATAGGGGTGGGAACGCAGCCCGG - Intergenic
969247744 4:5946242-5946264 AGGGTGGGAGGACGGCAGCCAGG + Intronic
969290931 4:6239641-6239663 AGGCGGTGAGGAAAGCTGCCTGG - Intergenic
969428828 4:7141101-7141123 TGAGTGGGAGGGAAGCGGCCTGG - Intergenic
969623137 4:8288929-8288951 AGAGGGGGAGGAAGGGAGGAAGG - Intronic
969788911 4:9478518-9478540 ACAGGGGTCGGAACGCAGCCCGG + Intergenic
970689734 4:18608816-18608838 AGGGTGGGAGGAAAGAAGCAGGG - Intergenic
971287931 4:25308188-25308210 ATGGAGGGAGGAAAGCAGGCAGG + Intergenic
971834837 4:31749321-31749343 AGAGGGGCAGGAAGGCAGGAAGG - Intergenic
972789471 4:42357259-42357281 AGAGGGGGAGGGAGGGAGGCGGG + Intergenic
972889740 4:43542307-43542329 AGAGAGGGAGGAAAGAAGGAAGG - Intergenic
973127232 4:46602361-46602383 ACAGAGGGATGAAAGCAGGCTGG - Intergenic
973763204 4:54139670-54139692 AGAGGGAGAGCACAGCAACCGGG + Intronic
974435883 4:61856898-61856920 AGGGAGGGAGGAAGGCAGGCAGG - Intronic
974865704 4:67578525-67578547 AGAGGGAGAGGAAGGAATCCTGG + Intronic
975762937 4:77635764-77635786 ATGGGGTGAGGACAGCAGCCAGG + Intergenic
975851605 4:78578360-78578382 AGAGAGGGAGGAAAGAAGGAAGG + Intronic
976633841 4:87267512-87267534 AGATGGAGAGGAAAGAAGCCTGG - Intergenic
977171606 4:93768993-93769015 AGAGAGAGAGGAAAGCAGTGTGG + Intronic
977693970 4:99946896-99946918 GGAGGCGGACGATAGCAGCCGGG + Intergenic
978133328 4:105226590-105226612 AGAGAGGGAGGGAAGGAGACAGG - Intronic
978393262 4:108250235-108250257 AGAGAGGGAGGAAGGAAGACAGG + Intergenic
978768792 4:112432269-112432291 ACAGAGGAAGGAAATCAGCCTGG + Exonic
979807939 4:124998186-124998208 AGAGAGGAGGGAAAGCAGCATGG + Intergenic
979959910 4:127005988-127006010 AGAGAGGAAGGAAAGAAGGCAGG + Intergenic
981094304 4:140762656-140762678 AGGGAGGGAGGAAAGAAGACAGG - Intergenic
981134556 4:141195442-141195464 AGAGGGAGAGGAAGGTAGTCAGG - Intronic
981498422 4:145419572-145419594 AGAGAGAGAGGAAAGGTGCCTGG + Intergenic
981681038 4:147398311-147398333 AGAGAGGGAGGAAAGAAGGGAGG + Intergenic
981769259 4:148288611-148288633 AGAGAGGTAGTAAAGCAGCTGGG - Intronic
981896639 4:149809981-149810003 AGAGAGAGAGGAAAGAAACCTGG - Intergenic
982112583 4:152070494-152070516 GGAAGGGGAGTAAAGCTGCCTGG + Intergenic
982465075 4:155720068-155720090 AGAAGGGGAGGAAGGCAGCACGG + Intronic
982868458 4:160546693-160546715 AGAGGAGGAGGAAGGCAGATGGG - Intergenic
983304025 4:165963157-165963179 AGAGGGAGAGGGAAGGAGACAGG + Intronic
984141241 4:176005882-176005904 GGAGGGGGAGAAGAGGAGCCCGG + Intergenic
984600568 4:181721654-181721676 GGAGGAAGAGGAATGCAGCCAGG + Intergenic
984654897 4:182307187-182307209 AGATGAAGAGGAATGCAGCCTGG + Intronic
984759013 4:183348061-183348083 GGAGGTGGAGGAAAGCAGATGGG - Intergenic
984760081 4:183356379-183356401 AGAGGGGGAGGAAAGAAGGGAGG - Intergenic
984768716 4:183419543-183419565 AGAGGAGGAGGAAAGCAGTCTGG - Intergenic
985064233 4:186105288-186105310 GTAGGGGGAGGAGAGCAGCGGGG - Intronic
985387813 4:189465483-189465505 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985387827 4:189465546-189465568 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985387854 4:189465651-189465673 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985387858 4:189465672-189465694 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985387862 4:189465693-189465715 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985387882 4:189465777-189465799 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985387912 4:189465903-189465925 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985387926 4:189465966-189465988 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985387930 4:189465987-189466009 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985387942 4:189466050-189466072 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985387946 4:189466071-189466093 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985388024 4:189466407-189466429 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985388047 4:189466512-189466534 GGAGGTGGAGGTAAGCAGCCTGG + Intergenic
985388063 4:189466575-189466597 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985388094 4:189466701-189466723 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985388121 4:189466806-189466828 GGAGGTGGAGGTAAGCAGCCTGG + Intergenic
985388128 4:189466827-189466849 GGGGGTGGAGGTAAGCAGCCTGG + Intergenic
985388135 4:189466848-189466870 GGGGGTGGAGGTAAGCAGCCTGG + Intergenic
985388197 4:189467121-189467143 GGAGGTGGAGCTAAGCAGCCTGG + Intergenic
985857875 5:2444497-2444519 AGAGAGAGGGGAGAGCAGCCAGG + Intergenic
985900034 5:2780937-2780959 GGAGGGTGAGGAAGGCGGCCAGG - Intergenic
986313849 5:6573153-6573175 AGACGGGCATGAAAGGAGCCGGG + Intergenic
986908299 5:12521748-12521770 AGATGGGGAGGAAAGACGACAGG - Intergenic
987243428 5:16024373-16024395 AGAGCAGGAGCAAGGCAGCCTGG - Intergenic
988123697 5:27001232-27001254 AGAGTGGGAGGAAAACATGCTGG + Intronic
988493126 5:31721962-31721984 AGAGAGGGAGGAACGAAGGCTGG - Intronic
988569833 5:32353288-32353310 GGAGGGTGAAGGAAGCAGCCTGG + Intergenic
988860725 5:35275399-35275421 AGATGGGGAGAAAAGCACTCAGG - Intergenic
989272250 5:39547156-39547178 TGAGGGGGAGGAAAGTAGGCAGG - Intergenic
989652856 5:43712906-43712928 AGATGGGGAGGAAAACTCCCTGG + Intergenic
990021642 5:51135058-51135080 AGAGGAGGAAGAAAGGAACCAGG - Intergenic
990100185 5:52174287-52174309 AGAGAGGGAGAAAAACAGACTGG - Intergenic
991198550 5:63962310-63962332 AGAGTGGGAGGGAAGGAGCCTGG - Intronic
991927634 5:71720204-71720226 AGAGGGCAAGAAAAGGAGCCAGG + Intronic
992093477 5:73339542-73339564 AGAGAGGGAAGACAGCAGCAGGG - Intergenic
992116177 5:73540506-73540528 AGGGAGGGAGGAAAGCGGCAGGG + Intergenic
992646387 5:78815540-78815562 AAAGGTGGAGGAAAGCATCTGGG + Intronic
993176567 5:84494359-84494381 AGGAGGGGAGGAAGGCAGGCAGG - Intergenic
993549355 5:89254763-89254785 AGAGAGGGAGGAAAGAAGGAGGG + Intergenic
993653308 5:90548369-90548391 GCAGGGGGAGGAAGCCAGCCAGG - Intronic
993901329 5:93585618-93585640 GCCGGGGGAGGAAGGCAGCCGGG - Intronic
994260816 5:97656437-97656459 AGGCAGAGAGGAAAGCAGCCAGG + Intergenic
994478036 5:100295683-100295705 AGAGGGTCAGGAAAGAATCCTGG + Intergenic
994981093 5:106875798-106875820 ACAGGGCGAGGACAGCAGCTAGG + Intergenic
995542415 5:113197894-113197916 AGAGGCGGAGGAAAGCACAGAGG + Intronic
995864994 5:116681135-116681157 TGAAGGGCAAGAAAGCAGCCTGG + Intergenic
997713794 5:136027862-136027884 AGAAGGGGAGGAAGGTAGCAGGG - Intergenic
998381431 5:141728861-141728883 AGAGGGGGAGGAAGGGAGGGAGG - Intergenic
998397367 5:141827376-141827398 AAAGGGGGAGCTAAGCAGCATGG - Intergenic
999240573 5:150125074-150125096 AGATGGGGCAGAAAGCAGGCAGG - Intronic
999300232 5:150486211-150486233 GGAGGGGGAGGAGAGCGGGCGGG + Intronic
999517303 5:152314440-152314462 AAAGGGGGAGGGAAGCAGAGGGG - Intergenic
1000011623 5:157238768-157238790 AGAGGGGCAGAAAAGCAGGAAGG - Intronic
1000024472 5:157346886-157346908 AAAAGGGGAGGCAAGCAGTCTGG - Intronic
1000188608 5:158886004-158886026 GCAGGAGGAGGAAAGGAGCCTGG + Intronic
1001108356 5:168875078-168875100 AGAGGGGGAGGAAAGAAGGGAGG + Intronic
1001268261 5:170291073-170291095 AGAGGGAGAAGAAAGAAGACAGG + Intronic
1001896324 5:175384990-175385012 AGAGGGGGAGGGAAGGAGAGAGG + Intergenic
1001897549 5:175394360-175394382 AGAGGGGGAGGCAAGCAAGATGG + Intergenic
1001933569 5:175689312-175689334 AGAGGGGGAAGAAGGGGGCCTGG - Intergenic
1002164650 5:177336857-177336879 GGAGGAGGAGGAACACAGCCAGG + Intronic
1002164664 5:177336933-177336955 GGAGGAGGAGGAACACAGCCAGG + Intronic
1002164680 5:177337009-177337031 GGAGGAGGAGGAACACAGCCAGG + Intronic
1002608896 5:180400904-180400926 AGAGAGGGAGGAATGCAGGGAGG - Intergenic
1002667621 5:180837482-180837504 TGAGGGTGGGGAAAGCAGCCAGG + Intergenic
1002718529 5:181244187-181244209 ATAGGGGCGGGGAAGCAGCCCGG - Exonic
1003187240 6:3842542-3842564 AGAGGGGCATGACAGAAGCCAGG - Intergenic
1003310451 6:4965570-4965592 AGAGGGGGAGAAAAGAGGACAGG + Intergenic
1003348543 6:5294253-5294275 GGAGGGGAAGGAAGGAAGCCAGG + Intronic
1004673940 6:17823429-17823451 AGAGAGGGAGGAAGGCAGGGAGG - Intronic
1004990779 6:21135862-21135884 GGAGGGAGAGGAAAGCTGTCAGG - Intronic
1005041192 6:21602046-21602068 AAATGGGGAGCAAAGCAGCGTGG + Intergenic
1005940195 6:30555128-30555150 AGAGGAGAAAGAGAGCAGCCCGG - Exonic
1005971326 6:30764134-30764156 AGAAGGGGAGGACAGGGGCCGGG + Intergenic
1006376956 6:33676982-33677004 AGAGAGGAAGGAGATCAGCCAGG - Intronic
1006383886 6:33718091-33718113 AGGGAGGGGGAAAAGCAGCCTGG - Intergenic
1006788352 6:36682784-36682806 GAAGGGGGAGGAGAGGAGCCAGG + Intronic
1006951268 6:37822676-37822698 GGAGGTAGAGGAAAGTAGCCTGG + Intronic
1007390727 6:41548158-41548180 AGTGAGCGAGGAAACCAGCCGGG - Intronic
1007477579 6:42129142-42129164 AGAGAGGGAGGAAAACAAGCTGG + Intronic
1007726729 6:43921314-43921336 AGAGGGGCAGAAAGGAAGCCTGG + Intergenic
1008689223 6:53958926-53958948 AGAAGGGGAAAAAAGTAGCCTGG + Intronic
1010800483 6:80168729-80168751 AGAGGGGGAGGGAGGCAGGGAGG + Intronic
1011099707 6:83708423-83708445 GGAGGAGGAGGGAGGCAGCCAGG - Intronic
1011259520 6:85456665-85456687 AGAGGGTGAGGAAAGAGGCCAGG + Intronic
1011547674 6:88499182-88499204 AGAAGGGGAGGGAGGGAGCCAGG + Intergenic
1011641242 6:89418214-89418236 AGGGAGGGAGGAAAGCAGGGAGG + Intergenic
1013366426 6:109441220-109441242 ATAGGGGGAGGAAGGCTGCATGG - Intronic
1013803453 6:113971475-113971497 AGTGGGGGAGGGGAGCAGCGTGG - Intronic
1014051359 6:116959070-116959092 AGAGAGAGAGGTAAGCAGGCAGG - Intergenic
1014092964 6:117426423-117426445 AGAGAGGAAGGAAGGCAGGCAGG - Intronic
1014568526 6:122980390-122980412 AGACGGGGAGGAAAGAAGCGGGG + Intergenic
1014752277 6:125269165-125269187 ACAGGGTGAGGACAGCAGCTAGG - Intronic
1015412968 6:132915219-132915241 AGAAGGGGAGTAAAGAAGCCTGG + Intergenic
1015521084 6:134131911-134131933 AGAGTGGGAGGAACCCAGCGAGG + Intergenic
1016046654 6:139487641-139487663 AGAGGCAGTGAAAAGCAGCCAGG + Intergenic
1016330117 6:142946001-142946023 GGAGGGGGAGGAAACCCCCCTGG + Intergenic
1017017440 6:150113209-150113231 AAAGGGGGAAGAAAGGAGGCTGG - Intergenic
1017985912 6:159443038-159443060 GCAGGTTGAGGAAAGCAGCCAGG - Intergenic
1018713393 6:166513688-166513710 AAAGGGGGAAGCAAGCAACCTGG + Intronic
1018906626 6:168079563-168079585 AGGGCGGGAGGAAGGCAGCCTGG + Intronic
1018938113 6:168287232-168287254 AGAGGTGGAGGAACAAAGCCAGG + Intergenic
1018964516 6:168474147-168474169 AGGTGGGGAGGAAAGCCCCCTGG + Intronic
1019419352 7:943435-943457 AGAGGAGGAGGAAGGGAGCGAGG + Intronic
1019419417 7:943679-943701 AGAGGAGGAGGAAGGGAGCGAGG + Intronic
1019469656 7:1211909-1211931 CCAGGGGGATGAAGGCAGCCAGG + Intergenic
1019510274 7:1414211-1414233 CGGGGTGGAGAAAAGCAGCCTGG + Intergenic
1019724092 7:2591373-2591395 ACAGGAGGAGGACAGGAGCCAGG - Intronic
1019908597 7:4083656-4083678 AGAGAGGGAGGAAAGAAGGGAGG - Intronic
1020311662 7:6873057-6873079 ACAGGGGTCGGAACGCAGCCTGG - Intergenic
1020672076 7:11128708-11128730 AGAACGGGAGGAAAGCAGTGGGG - Intronic
1020926059 7:14326217-14326239 AAAGCTGAAGGAAAGCAGCCTGG + Intronic
1021288992 7:18820626-18820648 AGAGGGAGAGGAAAAAAGCTAGG + Intronic
1021571991 7:22075279-22075301 AGAGAGTGAGGAAAACACCCTGG - Intergenic
1021633629 7:22669823-22669845 AGAAGGGAAGTAAAGCAGCAAGG - Intergenic
1022337307 7:29433864-29433886 AGAGGGGGAGGAAGGGAGGAAGG + Intronic
1022885589 7:34640061-34640083 AGAGGAGGATGAAAGGAGTCTGG + Intergenic
1023598048 7:41853307-41853329 AGTGAGGGAGGAAAGAATCCAGG + Intergenic
1023634556 7:42196798-42196820 AGAAGGGAAGGAAAGCAGAAAGG + Intronic
1024025994 7:45410320-45410342 AGGGGGGGATGGAAGAAGCCAGG + Intergenic
1024382049 7:48708281-48708303 AGAGGCTCAGGAAAGCTGCCAGG + Intergenic
1025024482 7:55505179-55505201 AGAGGAGGAGCAAAGTTGCCTGG - Intronic
1025031882 7:55564142-55564164 AGTTGGAGAGAAAAGCAGCCAGG - Intronic
1025117029 7:56267116-56267138 AGAGGGGGAGGAAGGGAGGAAGG - Intergenic
1025231715 7:57207148-57207170 AGGGAGGGAGGAAAGCAGGGAGG - Intergenic
1026598521 7:71754066-71754088 GGAGGGGGAGGAAAGTGCCCAGG - Intergenic
1026976059 7:74499163-74499185 GGAGTGGGAGGAACACAGCCTGG - Intronic
1027832854 7:83202139-83202161 AGGGAGGGAGGAAAACAGACAGG - Intergenic
1027863207 7:83611951-83611973 AGTGGGAGATGAAAGCAGCAAGG - Intronic
1028272916 7:88815791-88815813 AGTGGGAGAGGAAGGCAGCTTGG - Intronic
1028405539 7:90469819-90469841 AGAGGGAGAGGAAAACTGGCAGG - Intronic
1029090103 7:98041140-98041162 AGAGAGTGAGGAAGGCAGGCTGG - Intergenic
1029587877 7:101486976-101486998 GGAGGGGGAGGAAGGGAGCCTGG + Intronic
1029666173 7:101996609-101996631 AGGGAGGGAGGAAAGGAGTCAGG - Intronic
1029686689 7:102153371-102153393 AGGAGTGGATGAAAGCAGCCAGG + Intronic
1029843575 7:103390751-103390773 AGAGGTGGAGGAAAGATGTCTGG + Intronic
1030497247 7:110315436-110315458 AAAGAGGGAGGAAAGCAGGCGGG + Intergenic
1030936765 7:115594265-115594287 AGAAGGTAAAGAAAGCAGCCAGG + Intergenic
1031950029 7:127882349-127882371 GGAGGGGAAGGAAGGCAGGCAGG + Intronic
1032083883 7:128873584-128873606 AGCGTGGGAGGAAAGTAGCCTGG - Intronic
1032125486 7:129189575-129189597 AGAGGGCGGGGACAGCACCCGGG + Intronic
1032410166 7:131688930-131688952 AGTGGGGGAGGAGACCAGACTGG + Intergenic
1032509775 7:132463542-132463564 AGATGGGAAGGCAAGCTGCCAGG + Intronic
1032740121 7:134730220-134730242 AGAGAGGGAGGAAAGGAGGGAGG - Intergenic
1032840719 7:135711416-135711438 GGAGGCAGAGGAAAGCAACCAGG + Intronic
1033306262 7:140227986-140228008 AGACCAGGAGGAAAGCAGGCAGG - Intergenic
1033455530 7:141499833-141499855 AGAATGGGAGAAAAGCAGCTTGG + Intergenic
1033678984 7:143573888-143573910 AGAGGTGGAGGAATAAAGCCAGG - Exonic
1033692854 7:143755566-143755588 AGAGGTGGAGGAATAAAGCCAGG + Exonic
1033725438 7:144111180-144111202 GGAGGGGTAGGAAGGCAGCTGGG + Intergenic
1033740108 7:144267158-144267180 AGAGGTGGAGGAATAAAGCCAGG + Exonic
1033922089 7:146406622-146406644 GGAGGTGGAGGAGAACAGCCAGG + Intronic
1034684620 7:152959080-152959102 GGAGGGGTAGGAACGCATCCTGG + Intergenic
1034724667 7:153324495-153324517 AGAGGGGGAGGGAGGCAGGCAGG - Intergenic
1035000824 7:155610982-155611004 AGAGTGGGAGGAAAGAGGCTGGG - Intergenic
1036279351 8:7386354-7386376 GGAGAGGGAGGAAAGCAGGGAGG - Intergenic
1036304392 8:7589754-7589776 ACAGGGGTCGGAACGCAGCCCGG + Intergenic
1036342163 8:7925518-7925540 GGAGAGGGAGGAAAGCAGGGAGG + Intergenic
1036355244 8:8037746-8037768 ACAGGGGTCGGAACGCAGCCCGG + Intergenic
1036387682 8:8296174-8296196 AGAAAGGGAGGAAAGCCGCATGG - Intergenic
1036709595 8:11069492-11069514 AGTGGAGGAGGAGAGCAGACAGG - Intronic
1036903650 8:12690219-12690241 ACAGGGGTCGGAACGCAGCCCGG - Intergenic
1037588604 8:20294984-20295006 AGTGTGGGAGGCAAGGAGCCTGG + Intronic
1037741346 8:21611619-21611641 AGGGAGGGAGGAAAGGAGCAGGG + Intergenic
1037768988 8:21788073-21788095 CGAGGGGGAGGCGAGAAGCCGGG - Intronic
1038180054 8:25219122-25219144 AGAGGGGAGGGGAAGTAGCCAGG - Intronic
1038219171 8:25591538-25591560 AGAAGAGGAGGAAAGCAGACAGG - Intergenic
1038740949 8:30216125-30216147 AGGGAGGGAGGGAAGCATCCCGG - Intergenic
1038919691 8:32069049-32069071 AGATGGGAAGGAAAGCAGAATGG + Intronic
1041329936 8:56713909-56713931 GGAGGGGCAGGAAAGCTGTCTGG - Intergenic
1041763800 8:61395301-61395323 AGAGGGGGAGGAATGGAGAAAGG + Intronic
1043076354 8:75706291-75706313 AGAAGGAGAGGAAAGCAAACAGG - Intergenic
1043977266 8:86597573-86597595 AAAGGGTGGGGAAAGCATCCAGG + Intronic
1044118569 8:88365548-88365570 AGAGAGGGAGGGAGGCAGGCAGG + Intergenic
1044537053 8:93369491-93369513 GGAGGAAGAGGAAAGCAGCCTGG - Intergenic
1045218851 8:100176915-100176937 AGAGGGAGAGGAAAGGAGGAGGG - Intronic
1045881522 8:107045959-107045981 AGAGGGAGGGGAAAGCAGAGGGG + Intergenic
1046291804 8:112172087-112172109 AGTGTGGGAGGAAGACAGCCGGG + Intergenic
1046612390 8:116440433-116440455 ACAGGGGCAGGAGAGGAGCCTGG - Intergenic
1047312839 8:123706825-123706847 AAAGTGGGTGGAAAGTAGCCTGG - Intronic
1047601570 8:126430796-126430818 AGAGGTGGAGGATTGGAGCCAGG + Intergenic
1048026223 8:130589477-130589499 AGAGGGGGAGGAAGACAGGTAGG - Intergenic
1048382967 8:133884344-133884366 AGGGAGGGAGGAAGGCAGGCAGG + Intergenic
1048704197 8:137132564-137132586 AGAGGGGGGGGAAACCAACAGGG - Intergenic
1049073356 8:140374226-140374248 AGTGCTGGAGGACAGCAGCCAGG + Intronic
1049073524 8:140375517-140375539 GGAGAGGGAGGAATACAGCCTGG + Intronic
1049107159 8:140621290-140621312 GGAGGGGCAGGAAAGTGGCCTGG - Intronic
1049311812 8:141937472-141937494 AGAGAGGGAGGAAGGGAGACAGG - Intergenic
1049393607 8:142385114-142385136 AGGGAGGGAGGAAGGCAGGCAGG + Intronic
1049445367 8:142628001-142628023 AGAGGCTCAGCAAAGCAGCCTGG - Intergenic
1049715413 8:144087522-144087544 AGAGGCAGGGGAAACCAGCCAGG - Intergenic
1049879296 8:145051569-145051591 ATAGTGGGAGGGAAGCATCCAGG + Intergenic
1049880281 8:145057294-145057316 TGAATAGGAGGAAAGCAGCCAGG - Intergenic
1050176417 9:2873718-2873740 ACAAGGGCAGGAAAGTAGCCAGG - Intergenic
1050305344 9:4300026-4300048 AGGGAGGGAGGAAGGCAGCCGGG + Intronic
1051367829 9:16333751-16333773 AGATGGGGAAGAAAAGAGCCTGG + Intergenic
1051487117 9:17620867-17620889 AAAGGGGGAGGTAAGCAGAGGGG + Intronic
1053480958 9:38415866-38415888 AGAGGGGGAGGAAAGCAGCCTGG - Intronic
1056753782 9:89369764-89369786 ACAAGGGGAGGAAAGCCGTCTGG - Intronic
1057116186 9:92524599-92524621 AGAGCAGGAGGAAAGCTGCAAGG - Intronic
1057259381 9:93575779-93575801 AGAGGAAGAGGACAGAAGCCCGG - Intergenic
1058125620 9:101190873-101190895 ACAGTGGGAGGAAAGCAGAATGG + Intronic
1058473578 9:105306565-105306587 AGAGAGGGTGGGAAGCTGCCAGG - Intronic
1058523686 9:105836562-105836584 AGAGGTGGAGGAACGCAGAGTGG + Intergenic
1058791036 9:108445850-108445872 GGAGGGAGAAGAAAGCAGGCAGG - Intergenic
1059626119 9:116068393-116068415 AGAGAGGGAGAAAAGAAGGCAGG - Intergenic
1059685497 9:116631578-116631600 AGAGGGGGATGAAAACAGGCTGG + Intronic
1061077009 9:128347925-128347947 GGAGAGGGAAGAAGGCAGCCAGG + Intronic
1061695338 9:132369157-132369179 AAAGAGGAAGGAAAGAAGCCAGG - Intergenic
1062024265 9:134333067-134333089 CCAGGGGGAGTAGAGCAGCCGGG + Intronic
1062085489 9:134645955-134645977 AGAGAGGGAGGAAAGAAGGAAGG - Intronic
1062543623 9:137052356-137052378 GGAGGGGGAGGGAGTCAGCCTGG + Intronic
1185529722 X:807777-807799 AGAGGGGAAGGAAGGAAGCAAGG - Intergenic
1185787074 X:2899837-2899859 AGAGGGTGAGGTATTCAGCCTGG + Intergenic
1186410621 X:9342328-9342350 AGAGGGGGAGGGAAGGAGGGAGG - Intergenic
1187043189 X:15618260-15618282 AGAGGAGGAGGAGAGGTGCCAGG + Intergenic
1187277438 X:17828309-17828331 AGAGAGGGAGGCAAGCAGGAAGG - Intronic
1187327312 X:18303023-18303045 GGAGTGGGTGGAAAGCAGCCAGG - Intronic
1187415276 X:19087716-19087738 TGAGGTGGAAGGAAGCAGCCAGG + Intronic
1187591309 X:20720524-20720546 AGAGTGGAAGGAAGGAAGCCTGG - Intergenic
1187717036 X:22113098-22113120 AGTAGGGGTGGAAAGCAGCTGGG - Intronic
1187739122 X:22336238-22336260 AGAAAGGAAGGAATGCAGCCTGG - Intergenic
1188873651 X:35403819-35403841 AGAGGGGGAAGGAAGAGGCCAGG + Intergenic
1190644260 X:52510251-52510273 AGAGGGGGAGGAAGGAAGGAAGG - Intergenic
1190971684 X:55356302-55356324 AGAGAGTGAGGAAAGCAGGGTGG + Intergenic
1191848823 X:65570580-65570602 AGAGGAGTAAGAAAACAGCCAGG - Intergenic
1192157397 X:68756874-68756896 AGAGGGAGAGAGAAGCAGCAGGG + Intergenic
1192577686 X:72255832-72255854 AGAGGTGGGGGAAAGCAGAGAGG + Intronic
1193333319 X:80259669-80259691 GGTGGGGGAGGAAGGCAGACAGG + Intergenic
1193604855 X:83553823-83553845 AGAGTGGGAAGAAAGCAGGGAGG + Intergenic
1193890311 X:87036123-87036145 AGAGGGGGAGGGGAGGAGACTGG - Intergenic
1194267932 X:91778426-91778448 AGAGAGGGAGGAAACCAGCCCGG - Intergenic
1195065478 X:101234976-101234998 ATTGGAGGAGGAAATCAGCCTGG - Intronic
1195465365 X:105173420-105173442 AGAAGGGAAAGAAAGTAGCCAGG + Intronic
1196743571 X:119047436-119047458 AGGGAGGGAGGCAAGCAGGCAGG + Intergenic
1197469141 X:126846350-126846372 AGAGGGGGTGGAAAGCAAGAAGG + Intergenic
1197728803 X:129793661-129793683 AGAGGGCGCCGAGAGCAGCCAGG + Exonic
1197770144 X:130084390-130084412 GGTGGGGGAGGGAGGCAGCCAGG + Intronic
1197833092 X:130666163-130666185 AGAGGGCTATGAAAGGAGCCAGG - Intronic
1197971635 X:132120664-132120686 ACTGGAGCAGGAAAGCAGCCTGG + Intronic
1198065094 X:133088480-133088502 ACAGTGAGAGGTAAGCAGCCGGG - Intronic
1198477503 X:137009585-137009607 AGGGTGGGAGGGAAGCAGGCAGG + Intergenic
1199850347 X:151721557-151721579 AGAGGGGCTGGTGAGCAGCCTGG + Intronic
1200120470 X:153787831-153787853 AGAGGGCGAGTACAGCAGCCTGG - Exonic
1200585138 Y:4999351-4999373 AGAGAGGGAGGAAACCAGCCCGG - Intergenic
1200709310 Y:6469386-6469408 AGAGGGGGAGGTCAAGAGCCTGG - Intergenic
1201024802 Y:9695322-9695344 AGAGGGGGAGGTCAAGAGCCTGG + Intergenic
1201366189 Y:13208836-13208858 AGAGAGCCAGGAAAGGAGCCAGG + Intergenic
1201550282 Y:15211297-15211319 AGAGAGGGAGGAAAGGAGAGAGG + Intergenic
1201608381 Y:15813117-15813139 AGAAGGGCAGGACAGCAGGCTGG + Intergenic