ID: 1053480959

View in Genome Browser
Species Human (GRCh38)
Location 9:38415878-38415900
Sequence GGTGGATCAGATAGAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 298}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480959_1053480967 4 Left 1053480959 9:38415878-38415900 CCTCCCCCTCTATCTGATCCACC 0: 1
1: 0
2: 0
3: 21
4: 298
Right 1053480967 9:38415905-38415927 CATTCAGCTGTACCCATCTGAGG No data
1053480959_1053480970 16 Left 1053480959 9:38415878-38415900 CCTCCCCCTCTATCTGATCCACC 0: 1
1: 0
2: 0
3: 21
4: 298
Right 1053480970 9:38415917-38415939 CCCATCTGAGGGCCCTCTGAAGG No data
1053480959_1053480972 17 Left 1053480959 9:38415878-38415900 CCTCCCCCTCTATCTGATCCACC 0: 1
1: 0
2: 0
3: 21
4: 298
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480959_1053480968 5 Left 1053480959 9:38415878-38415900 CCTCCCCCTCTATCTGATCCACC 0: 1
1: 0
2: 0
3: 21
4: 298
Right 1053480968 9:38415906-38415928 ATTCAGCTGTACCCATCTGAGGG No data
1053480959_1053480973 20 Left 1053480959 9:38415878-38415900 CCTCCCCCTCTATCTGATCCACC 0: 1
1: 0
2: 0
3: 21
4: 298
Right 1053480973 9:38415921-38415943 TCTGAGGGCCCTCTGAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480959 Original CRISPR GGTGGATCAGATAGAGGGGG AGG (reversed) Intronic
900169481 1:1259652-1259674 GGTGGATCAGCTCGAGGAAGGGG - Intronic
900192488 1:1357338-1357360 GGTGGATCAGCTCGAGGACGGGG - Intronic
900921384 1:5673281-5673303 GGAGGAAGAGAGAGAGGGGGAGG - Intergenic
902291832 1:15440411-15440433 GGAGGTACAGATAGAGAGGGTGG + Intronic
906943330 1:50275053-50275075 GGGGGACCAGAGAGAGGGAGAGG - Intergenic
907240661 1:53079225-53079247 GGTGGGTCAGGCAGAGGGTGTGG + Intronic
909979818 1:82085368-82085390 GGTGGAGAAGGTGGAGGGGGAGG + Intergenic
910068204 1:83179381-83179403 GGTGTATCAGATACATGGGGTGG + Intergenic
910456702 1:87405451-87405473 GGTGGAAGAGATAGAGGCAGTGG - Intergenic
910596090 1:88982670-88982692 AGCCGATCTGATAGAGGGGGAGG - Exonic
912691082 1:111805046-111805068 GGTGGATCACATAAAGGGCAGGG + Intronic
913615244 1:120552732-120552754 GGTGGACTGGATAGAGGGAGAGG + Intergenic
914333829 1:146697573-146697595 GGTGGATTTGATAGGGTGGGTGG - Intergenic
914575029 1:148958176-148958198 GGTGGACTGGATAGAGGGAGAGG - Intronic
917150069 1:171933612-171933634 GGTGGATGAGTGAGACGGGGTGG + Intronic
917547720 1:175989101-175989123 GGAGGATGAGATAAGGGGGGAGG + Intronic
919584203 1:199416058-199416080 GGAGGAAGAGAGAGAGGGGGAGG - Intergenic
919597453 1:199581395-199581417 GGAGGAAGAGAGAGAGGGGGAGG - Intergenic
919671648 1:200343884-200343906 GGTGGAAAAGATAGTTGGGGTGG - Intergenic
920038468 1:203080816-203080838 GGTGGATCAACTGGAGAGGGAGG - Intergenic
921818552 1:219590933-219590955 GGTGGCTCAGACAGAGATGGAGG + Intergenic
921887514 1:220321593-220321615 GGAGGATGAGAGAGAGGTGGTGG + Intergenic
922002361 1:221492380-221492402 GGTGGAAGAGGTAGAGGAGGTGG + Intergenic
923146482 1:231202196-231202218 GGTGGCTGAGATAGTGGAGGAGG + Intronic
923161271 1:231316913-231316935 GGTGGAAGAGATGGAGGGGATGG - Intergenic
923856435 1:237849817-237849839 GGAGGATGAGAGAGAGGGAGGGG + Intergenic
924130753 1:240905619-240905641 GGTGGATCAGACAGAAGGAATGG + Intronic
1063263425 10:4416878-4416900 GATGGATTAGATGGAGAGGGAGG - Intergenic
1064774447 10:18760179-18760201 AGTGGATCAGAGAAAGGGGTGGG + Intergenic
1064963765 10:20994870-20994892 GGAGGAGGAGGTAGAGGGGGGGG + Intronic
1065178394 10:23100618-23100640 GGAGGAAGAGAGAGAGGGGGAGG + Intronic
1065325076 10:24543698-24543720 GGAGGAAAAGATAGAGGAGGAGG + Exonic
1065603560 10:27393440-27393462 GTGGGATCACATAGAGGGGAAGG + Intergenic
1066208156 10:33209894-33209916 GGTAGATCAGATGGAGTGGCTGG + Intronic
1067520662 10:47000176-47000198 GGTCACTCAGATAGAAGGGGAGG + Intronic
1068117026 10:52746889-52746911 GGTGGATGAGTTATATGGGGTGG - Intergenic
1068631018 10:59297724-59297746 AGTGAATGAGATAGAGGGGATGG - Intronic
1071298638 10:84240662-84240684 GAGGGATCAGACAGAGGGTGGGG + Intronic
1076585592 10:131545365-131545387 GGTGGATGAGAGAGACAGGGCGG + Intergenic
1077165873 11:1138043-1138065 GGTGGAAGAGATGGAGGAGGTGG + Intergenic
1077256381 11:1585267-1585289 GGTGGAGCAGGTAGAGGAGCAGG + Exonic
1077258122 11:1598268-1598290 GGTGGAGCAGGTAGAGGAGCAGG + Exonic
1077259531 11:1608403-1608425 GGTGGAGCAGGTAGAGGAGCAGG + Exonic
1077262393 11:1629801-1629823 GGTGGAGCAGGTAGAGGAGCAGG - Exonic
1077274428 11:1697206-1697228 GGTGGAGCAGGTAGAGGAGCAGG - Exonic
1077632083 11:3817619-3817641 GGAGGATCAGAGAGAGGGAAAGG + Intronic
1079310587 11:19361976-19361998 GGGGGATAAGGTAGAGGGGATGG + Intronic
1080528858 11:33154283-33154305 TGTGGAACAGATAGATGAGGTGG - Intronic
1082730913 11:56796426-56796448 GGTGGAGTAGATAGAAGAGGGGG + Intergenic
1082771561 11:57211562-57211584 GGTGGAGGAGATGGAAGGGGAGG - Intergenic
1084798741 11:71527261-71527283 GGTGGAGCAGGTAGAGGAGCAGG - Exonic
1084800079 11:71538016-71538038 GGTGGAGCAGGTAGAGGAGCAGG - Exonic
1084801747 11:71548618-71548640 GGTGGAGCAGGTAGAGGAGCAGG - Exonic
1084803839 11:71565548-71565570 GGTGGATCAGGTAGAGGAGCAGG - Exonic
1085130102 11:74030916-74030938 AGAGGATTAGATAGAGGGGCAGG - Intronic
1085297503 11:75439369-75439391 AGTGCAGCAGAGAGAGGGGGAGG + Intronic
1085962694 11:81481567-81481589 TGTAGATCAGATATGGGGGGTGG + Intergenic
1087010775 11:93511916-93511938 GGTGGATCAGTGAGTGAGGGTGG - Intronic
1088919665 11:114251755-114251777 GGAGGAGCAGAAGGAGGGGGAGG + Intergenic
1088919846 11:114252810-114252832 GGTGGATGAGATTGAAGGGGAGG - Intergenic
1089054022 11:115570051-115570073 GGAGGATGAAATAGAGGGGGAGG + Intergenic
1089779837 11:120866081-120866103 GGTGGGTTGGATAAAGGGGGTGG - Intronic
1091237383 11:134031285-134031307 GGTGGATGAGAAAGACGGGAGGG + Intergenic
1091760547 12:3084448-3084470 GGTGGAGCAGGGAGAGGGGGTGG + Intronic
1091797200 12:3304178-3304200 GGTGGGCAAGATGGAGGGGGGGG + Intergenic
1091999361 12:5019846-5019868 GGTGGAAGAGATGGAGGAGGAGG - Intergenic
1092237469 12:6819090-6819112 GGTGGAGAGGATAGAGGGGTGGG + Intronic
1092564360 12:9648609-9648631 GTTGGATCAGAGAGAGGTTGGGG - Intergenic
1093967831 12:25345825-25345847 GGTGGAAGAGATGGAGGGAGAGG - Intergenic
1097719032 12:63000529-63000551 GGTGGAACAAAGAGAGAGGGAGG - Intergenic
1099288038 12:80739521-80739543 GGTGGAGAAGGTAGAGGAGGTGG + Intergenic
1101247780 12:102901212-102901234 AGTGAATAAGATAGAGGAGGAGG - Intronic
1102394284 12:112574323-112574345 GGTGGAGCACGGAGAGGGGGTGG + Intronic
1102394391 12:112574661-112574683 GGTGGAGGAGAGAGAGGGGGTGG + Intronic
1102394436 12:112574796-112574818 GGTGGAGGAGGGAGAGGGGGTGG + Intronic
1102394445 12:112574817-112574839 GGTGGAGGAGGGAGAGGGGGTGG + Intronic
1102394470 12:112574890-112574912 GGTGGAGGAGGGAGAGGGGGTGG + Intronic
1102457903 12:113082248-113082270 GGAGGATCAGTTAGAGGGGCTGG - Intronic
1102848381 12:116213231-116213253 GGTGGACAAGAAAGAGGGGAGGG + Intronic
1105531149 13:21221779-21221801 GGTAGATCAGAGAAAGGTGGGGG - Intergenic
1105607891 13:21942273-21942295 GGTGGATCAGATCCAAGAGGGGG + Intergenic
1106090793 13:26591474-26591496 GGTGGATCTGACAGTGAGGGAGG + Intronic
1106736615 13:32593837-32593859 GGTGGAAGAGAGAGAGGAGGTGG + Intronic
1111929342 13:94497744-94497766 GGTGGAAGAGGTAGAGGGGATGG + Intergenic
1112067325 13:95807333-95807355 GGTGGAGGAGGTAGAAGGGGAGG + Intronic
1112550841 13:100418941-100418963 GATGGAGCAGAGAGAAGGGGAGG - Intronic
1113088401 13:106592175-106592197 GGTGGAGGAGGTAGAAGGGGAGG - Intergenic
1113240286 13:108329092-108329114 GGTGGATCAGGCAGTGGGTGGGG - Intergenic
1114557963 14:23572468-23572490 GGTGGCTCTGAACGAGGGGGCGG - Intronic
1114940701 14:27606851-27606873 GGTGGAACAAATAGAAAGGGAGG - Intergenic
1115084165 14:29493244-29493266 AGTGGATGAGAGAGAGAGGGAGG + Intergenic
1115253472 14:31373781-31373803 GGTGGAGCAGGTGGAAGGGGAGG - Intronic
1117959899 14:61152424-61152446 GGTGGAGGAGAAAGAGGAGGAGG + Intergenic
1118054566 14:62066245-62066267 GGAGAATCAGAGAGAGGTGGTGG - Intronic
1119092389 14:71796787-71796809 GGTGGAGGAGGTAGATGGGGAGG - Intergenic
1120893412 14:89509077-89509099 GGTGGAACAGAGTGAGAGGGAGG - Intronic
1123450620 15:20357278-20357300 GTGGGACCAGAGAGAGGGGGTGG + Intergenic
1125728586 15:41880611-41880633 GGTGGAGCAGGCAGAGGGAGCGG - Intronic
1129635239 15:77309646-77309668 GGTGGATTAAATAAAGGGTGGGG - Intronic
1132956039 16:2594086-2594108 GGTGGGTCAGATGGTGGGGCTGG + Intronic
1134075799 16:11290487-11290509 GCTGGAGCAGAGAGAGGTGGGGG + Intronic
1134649592 16:15898180-15898202 GGGGGAGGAGATAGAAGGGGAGG - Intergenic
1135834333 16:25811215-25811237 GGTGGAGCAGATGGAAGGGGAGG - Intronic
1138599236 16:58045275-58045297 GGTGGTGCAGATGGAGGAGGTGG + Exonic
1139059009 16:63225446-63225468 GGTGGAGCAGGTGGAAGGGGTGG + Intergenic
1139591799 16:67937058-67937080 AGGGGCTCAGATGGAGGGGGAGG - Exonic
1139999788 16:71013676-71013698 GGTGGATTTGATAGGGTGGGTGG + Intronic
1142254345 16:89006749-89006771 TGGGGAAGAGATAGAGGGGGAGG - Intergenic
1142254370 16:89006810-89006832 TGGGGAGGAGATAGAGGGGGAGG - Intergenic
1142320280 16:89377841-89377863 GGTGGAAGAGGTAGAAGGGGAGG - Intronic
1142469158 17:153106-153128 CGTGGCTCAGATACAGGGAGTGG + Intronic
1142533379 17:597522-597544 GGTGGATCAGCTAGATTAGGGGG + Intronic
1142836918 17:2594028-2594050 GGTGGAGGAGACAGAGGGGAGGG - Intronic
1143618836 17:8069627-8069649 GGTGGGACAGGTAGAGGGAGTGG - Intergenic
1143635091 17:8159830-8159852 GGTGGATCAGGCAGATGGGAGGG + Exonic
1144639600 17:16930291-16930313 GGTTGGTGAGACAGAGGGGGTGG - Intronic
1144698249 17:17320428-17320450 GATGGATCTGATATTGGGGGTGG + Intronic
1147905821 17:43822498-43822520 GGTTGATGAGATAGAGAGGAGGG - Intronic
1148163857 17:45468704-45468726 AGTGGATCATTTAGAGGGTGTGG - Intronic
1148781320 17:50123679-50123701 GGAGGAGCAGGAAGAGGGGGAGG - Intronic
1150395087 17:64815356-64815378 AGTGGATCATTTAGAGGGTGTGG - Intergenic
1151529990 17:74698120-74698142 GGTGGATCAGAGAGAAGAGAAGG + Intronic
1152156851 17:78639689-78639711 GGTGAATGAGAGAGAGGGGAGGG - Intergenic
1154121884 18:11658772-11658794 GTTGGATTGGATAGAGGAGGAGG - Intergenic
1155276754 18:24195670-24195692 GGTGGATCTGATGTGGGGGGAGG - Intronic
1160986113 19:1839716-1839738 AGTGGATGAGACAGAGAGGGAGG - Intronic
1161458281 19:4381033-4381055 GGGGGAACAGAGAGAGGGAGAGG - Intronic
1161842937 19:6693647-6693669 GGGGGATCAGAACGAGGAGGTGG + Intronic
1161857108 19:6772398-6772420 GCTGGACCAGACAGAGGAGGGGG + Intergenic
1162528667 19:11222744-11222766 GGTGGAGGACACAGAGGGGGAGG + Exonic
1163152444 19:15423242-15423264 GGGGGAACAGAGAGAGGGAGTGG + Intronic
1164156907 19:22602632-22602654 GGTGGACCTGAAAGAGCGGGTGG + Intergenic
1164507843 19:28874171-28874193 GGTGGAAGAGATGGAGGGGATGG + Intergenic
1165617916 19:37218358-37218380 GGTCGGGCTGATAGAGGGGGTGG + Intronic
1166753884 19:45178973-45178995 GGTGGACCAGGTGGAGGGTGTGG + Intronic
1166927546 19:46279232-46279254 TGAGGGTCAGATAGAGGAGGTGG - Intergenic
1167687292 19:50964324-50964346 GGTGGAACAGAAAGCAGGGGAGG - Intronic
1168198047 19:54790383-54790405 GGAGCCTCAGATGGAGGGGGTGG + Intronic
1168288987 19:55347820-55347842 GGTGGAACTGATGTAGGGGGTGG + Exonic
1168337634 19:55605531-55605553 GGAGGATCGGAAAGAGGAGGCGG - Intronic
925335627 2:3097291-3097313 GGTGGAACAGAAAGAGAGGGCGG - Intergenic
926126870 2:10277428-10277450 GGTGGACCAGATGGAGGACGGGG + Intergenic
927446815 2:23169740-23169762 GGAGGAAGAGAGAGAGGGGGAGG - Intergenic
927634954 2:24807116-24807138 GGTGGAAAAGGAAGAGGGGGAGG - Intronic
928706218 2:33952585-33952607 GGTGGAAGAGATAGGGAGGGAGG - Intergenic
929197078 2:39196085-39196107 GGTGGATCAGGCAGTGGGTGGGG - Intronic
930610246 2:53534485-53534507 AGTGGAGGAGATAGAAGGGGAGG - Intronic
931320396 2:61170315-61170337 GGTGGAGGAGGTAGAAGGGGAGG - Intergenic
932180817 2:69644175-69644197 GGTGGAACATACAGCGGGGGGGG - Intronic
932546705 2:72719127-72719149 GGTGGAGGAATTAGAGGGGGAGG - Intronic
932555381 2:72819496-72819518 GGTGGAGCAGAGAAAGGAGGAGG - Intronic
933830676 2:86205444-86205466 GGTGGAGGAGTTAGAAGGGGAGG + Intronic
934955494 2:98614322-98614344 GGGGGATCAGGAAGAGGGAGTGG + Intronic
936496557 2:113027267-113027289 GGTGGAGGAGTTAGAGGGGGAGG + Intronic
937078848 2:119126174-119126196 GTTTGATCAGATATTGGGGGTGG - Intergenic
937160843 2:119759824-119759846 GGAGGAAGAGATAGAGGAGGAGG + Exonic
937723031 2:125126078-125126100 GGAGGATCAGAGAGTGGGCGGGG + Intergenic
938216620 2:129523135-129523157 GGAGGATCAGATGGTGGGTGTGG + Intergenic
938655691 2:133430837-133430859 GGTGGATTAAATAGTGGGGGTGG + Intronic
938868316 2:135447586-135447608 GGTGGTTCAGAATGAAGGGGTGG + Intronic
938880290 2:135579345-135579367 GGTAGATAAGATAGATGGGAGGG + Intronic
942587156 2:177493624-177493646 TGTGGCTCAAATAGAGGGTGGGG + Intronic
942695968 2:178645958-178645980 GGTGGAGCAGGTGGAGGAGGTGG + Exonic
947247898 2:228070342-228070364 GGTGGATGAAGTAGAGGAGGCGG + Intronic
947557090 2:231102712-231102734 GGTGGAGGAGGTAGAAGGGGAGG + Intronic
947999475 2:234555948-234555970 AGTGGATCAGATGGTGGAGGTGG - Intergenic
948477005 2:238226809-238226831 GGAGGATGAGACAGAGGAGGGGG - Intronic
948765686 2:240217571-240217593 GGTGGAGCTGAAAGAGTGGGCGG - Intergenic
1169595209 20:7190623-7190645 GGTGGAGCAGAAAGAGGAGTAGG + Intergenic
1169974406 20:11307216-11307238 TGTGGTTCAGATAGAGGGAACGG + Intergenic
1171088472 20:22261856-22261878 GCTAGAGCAGAGAGAGGGGGAGG - Intergenic
1171313509 20:24166126-24166148 GGGGGATCAGATATCAGGGGCGG - Intergenic
1171418117 20:24997407-24997429 GGTGGAGCAGGTGGAAGGGGAGG - Intergenic
1171773316 20:29343921-29343943 GGAGGATGAGAGAAAGGGGGGGG + Intergenic
1171903028 20:30874554-30874576 GGAGGAAGAGAGAGAGGGGGAGG - Intergenic
1172904035 20:38355670-38355692 GGTGGAGCAGAGGGAGGGGCTGG - Intronic
1173481076 20:43399891-43399913 GGAGAATCAGATAATGGGGGAGG - Intergenic
1173648120 20:44646235-44646257 GGAGGATCAGAGAGAGGAAGTGG - Intronic
1174661025 20:52213253-52213275 GGTGGGTCAGCTAGAGGTGGGGG + Intergenic
1175028400 20:55927854-55927876 AGTGGACCAGACAGAGGAGGTGG + Intergenic
1175128948 20:56774835-56774857 GCTTGGTCAGATAGAGGGGATGG - Intergenic
1175300218 20:57937775-57937797 GATGGATCAGATGTTGGGGGAGG + Intergenic
1175417840 20:58813236-58813258 AGTGGGTGAGATGGAGGGGGTGG - Intergenic
1175902561 20:62365898-62365920 GGTGGGGCAGGCAGAGGGGGCGG + Intronic
1176009075 20:62882144-62882166 GGTGGTTCTGGAAGAGGGGGCGG + Exonic
1178299202 21:31437710-31437732 GGTGGAAGAGAGAGAGAGGGTGG - Intronic
1179051981 21:37896131-37896153 GGAGGAAGAGACAGAGGGGGAGG + Intronic
1179602594 21:42490116-42490138 GGGGGATGAGATGGAGGGGAGGG - Intronic
1180336422 22:11580525-11580547 GGAGGAAGAGAGAGAGGGGGAGG - Intergenic
1180703282 22:17793419-17793441 GATCCATCAGATAGAGGGGCAGG - Intronic
1180974359 22:19839119-19839141 CATGGATCAGAAGGAGGGGGAGG + Intronic
1181404238 22:22670889-22670911 GGAAAATCAGAGAGAGGGGGAGG + Intergenic
1181406314 22:22687321-22687343 AGAGGATGAAATAGAGGGGGAGG - Intergenic
1181414260 22:22747961-22747983 AGGGGATGAAATAGAGGGGGAGG - Intronic
1182923473 22:34101460-34101482 GGAGATTCAGATAGAGGGAGTGG + Intergenic
1184244783 22:43230438-43230460 GGTGGAAAAGATACAGGTGGGGG + Intronic
1184351983 22:43950442-43950464 GGTGGTTCAGGAAGAGAGGGAGG - Intronic
949150188 3:757506-757528 GGTGGATCAGGTAGGTGGGTGGG + Intergenic
949364275 3:3263687-3263709 GGTGGAGGAGGTAGAAGGGGAGG + Intergenic
949364380 3:3264816-3264838 GGTGGAGGAGGTAGAAGGGGAGG - Intergenic
950847989 3:16033347-16033369 GGTGGAACAGGTGGAGGAGGTGG + Intergenic
950861811 3:16154385-16154407 GGGGCATCAGATAGAGTGAGAGG + Intergenic
953365445 3:42340509-42340531 GGAGGAGCAGGGAGAGGGGGAGG + Intergenic
953749829 3:45600709-45600731 GGTGGATCACATGGAGGAGACGG - Intronic
953842821 3:46403581-46403603 GGTGGATCAGCTGGGGAGGGAGG - Intergenic
954363896 3:50136349-50136371 GGGGGGTCAGGGAGAGGGGGTGG - Intergenic
954848230 3:53578253-53578275 GGAGGACTAGATGGAGGGGGTGG + Intronic
955067312 3:55544407-55544429 GGTGGATGTGATAGAGCTGGGGG - Intronic
955376141 3:58398668-58398690 GCTGGAGCAGAGAGAGGGGAGGG + Intronic
958564211 3:95787028-95787050 AGAGGATCAGAGAGAGAGGGAGG - Intergenic
960170506 3:114455039-114455061 GGGGGAAGAGAGAGAGGGGGGGG + Intronic
961736616 3:129005676-129005698 GGTGGAGCAGCCAGAAGGGGTGG + Intronic
962351722 3:134661239-134661261 GATGGATCGGATAGATGGAGTGG - Intronic
962978600 3:140467764-140467786 GATGGAACAGAGAGAGGGTGGGG - Intronic
964040285 3:152253197-152253219 GATGGAGCAGACAGAGGGGTAGG - Intronic
965451703 3:168846160-168846182 GGTGGAGGAGAAAGAGGAGGAGG - Intergenic
967429320 3:189363420-189363442 GATGGAACAGATAGAGGAGCTGG - Intergenic
969229876 4:5822482-5822504 GGTGGATCTGAAGGGGGGGGGGG + Intronic
971085728 4:23273073-23273095 GATTTATCAGATAGAGGTGGGGG + Intergenic
971321989 4:25613096-25613118 GGTGGATCAGGTAGAGACAGAGG + Intergenic
974911113 4:68121087-68121109 GGTGGGTCATATAGAAGGGGAGG - Intronic
975802749 4:78079345-78079367 AATGGACCAGATAGATGGGGTGG + Intronic
978494649 4:109346342-109346364 AGCCGATCTGATAGAGGGGGAGG - Intergenic
979459719 4:120968138-120968160 GGTGGAGGAGGTAGAAGGGGAGG - Intergenic
981571716 4:146158730-146158752 GGTGGAGGAGATGGAAGGGGAGG - Intergenic
983260410 4:165450415-165450437 GATGGATGAGATTGAGTGGGAGG + Intronic
984019712 4:174470294-174470316 GGTGGAAGAGATGGAGGAGGTGG + Intergenic
987455129 5:18134871-18134893 GGTGGAGGAGGTAGATGGGGAGG - Intergenic
988430657 5:31115066-31115088 GGAGGAAGAGATAAAGGGGGAGG - Intergenic
988796391 5:34656617-34656639 GGTGGACCAGGGAGAGGTGGCGG - Intronic
989731867 5:44658577-44658599 GGTGGAAAAGATGGAGGAGGTGG + Intergenic
989813479 5:45707212-45707234 GTTGTCTCAGAAAGAGGGGGAGG + Intergenic
990158223 5:52904336-52904358 GGTGGGTGCGATAGTGGGGGTGG - Intronic
991057971 5:62340440-62340462 GGTGGATCAGAGAAATGGGATGG + Intronic
993022028 5:82603632-82603654 GGGGGATCAGTCAGAGAGGGTGG + Intergenic
993519654 5:88884586-88884608 TGTGGAAAAGATAGAGTGGGGGG - Intronic
994608529 5:102004538-102004560 GGAGGATGACAGAGAGGGGGAGG + Intergenic
996093714 5:119376564-119376586 GGGGGAGCAGAAAGACGGGGGGG - Intronic
997884115 5:137615450-137615472 GGTGGAACAGAGAGGAGGGGTGG - Intergenic
999125656 5:149244096-149244118 GGTAGAGCAGAGAGAGGGGCTGG - Intronic
999391808 5:151198883-151198905 TGTGGATCAGACAGACAGGGAGG + Intronic
999793616 5:154966802-154966824 GGTGGCTCAGGTGGAGGTGGGGG - Exonic
1000502292 5:162067209-162067231 GGGGGAGCAGACAGTGGGGGAGG - Intergenic
1002022393 5:176372099-176372121 GGTGGGTGAGACAGAGGGTGGGG + Exonic
1003504086 6:6725533-6725555 GGTGACCCAGATGGAGGGGGAGG - Intergenic
1003834194 6:10050351-10050373 GTTGCTTCAGCTAGAGGGGGAGG - Intronic
1005691486 6:28311235-28311257 GGAGGATCAGACAGTGGGTGGGG + Intergenic
1006479635 6:34281351-34281373 GGTGTATCAGAGAGAGGAAGTGG - Exonic
1006924718 6:37648096-37648118 GGTGGGTCAGAAAGGGGTGGAGG - Intronic
1007607193 6:43125516-43125538 GGTGGGTGGGATAGAGGGGAAGG - Intronic
1008171515 6:48213620-48213642 AGCCGATCTGATAGAGGGGGAGG - Intergenic
1008185020 6:48378065-48378087 GGAGGAAGACATAGAGGGGGAGG - Intergenic
1009567130 6:65323715-65323737 GGTGGCTCAGACAGAGATGGAGG - Intronic
1012355470 6:98308739-98308761 GGTGAATCATATGGAGGCGGTGG - Intergenic
1013363329 6:109415117-109415139 GGTGGACGAGGTAGAAGGGGAGG + Intronic
1013731439 6:113172824-113172846 CGAGGAGGAGATAGAGGGGGTGG + Intergenic
1017907971 6:158769792-158769814 GGTGGATCAGATAAAGAGCCAGG - Exonic
1018340945 6:162850646-162850668 GGTGGATCACCTGGAGAGGGCGG + Intronic
1018575928 6:165259906-165259928 GGAGGAAGAGAGAGAGGGGGAGG + Intergenic
1018732900 6:166666218-166666240 TGTGCATCAGAGAGAGGGGGCGG + Intronic
1019864175 7:3689427-3689449 GGTGGAACAGAGAGAGGGAGGGG + Intronic
1023113061 7:36833753-36833775 GGTGAGTCAGATAGTTGGGGTGG - Intergenic
1024996185 7:55274606-55274628 GGTGGATGAGAGAGAGGGGAGGG - Intergenic
1027275893 7:76555381-76555403 GGTGTATCAGATACATGGGGTGG - Intergenic
1028110493 7:86934901-86934923 GGTTGATAAGATGGAGGGGGAGG - Intronic
1029165509 7:98586874-98586896 GGTGGAAGAGGTAGAGGAGGTGG + Intergenic
1029528302 7:101108873-101108895 GGTGGCTCAGAAAGAGAAGGGGG + Intergenic
1030005264 7:105112386-105112408 GGTGGAGGAGGTGGAGGGGGTGG - Exonic
1030220363 7:107092153-107092175 TTTGGATCAGATTGTGGGGGAGG + Intronic
1032523767 7:132564045-132564067 GGAGGAGGAGAAAGAGGGGGAGG - Intronic
1037193124 8:16152079-16152101 GGAGGATGAGGAAGAGGGGGAGG - Intronic
1037250648 8:16889912-16889934 GGAGTCTCAGATAGAGGGGAGGG - Intergenic
1037781280 8:21870845-21870867 TCAGGATCAGATACAGGGGGAGG + Intergenic
1039986385 8:42451649-42451671 GGAGGAAGAGATAGAGGGGGAGG + Intronic
1041475510 8:58260764-58260786 GGTGGGAAAGAGAGAGGGGGAGG + Intergenic
1041811762 8:61919299-61919321 GTTGGATCTGAAAGAGGGAGAGG + Intergenic
1041927049 8:63248114-63248136 GGAGGATCAGATGGTGGGTGGGG + Intergenic
1043220994 8:77663541-77663563 GGTTGATCAGGTATAGGGGGAGG - Intergenic
1043462047 8:80470074-80470096 GGTGGGTCAGATAGTGTGGCTGG - Intergenic
1043804533 8:84654962-84654984 GCTGGATCATATGGTGGGGGTGG + Intronic
1048266308 8:132990572-132990594 GGAAGATCAGAGGGAGGGGGAGG - Intronic
1049378907 8:142302371-142302393 GGAGGATCTGACAGAGGTGGGGG + Intronic
1049530317 8:143151306-143151328 AGTGGATGAGACAGAGGAGGTGG - Intergenic
1050288503 9:4129541-4129563 GGAGGAAGAGAGAGAGGGGGAGG - Intronic
1050811712 9:9756551-9756573 AGTGGAGCAGATAGGGGGTGGGG + Intronic
1051882788 9:21857049-21857071 GGTGGCTCTGATGGAGTGGGGGG + Intronic
1052605246 9:30690241-30690263 AGCCGATCTGATAGAGGGGGAGG + Intergenic
1053135182 9:35646443-35646465 AGTCGATCAGCTAGAGGGTGTGG + Intronic
1053417023 9:37953208-37953230 GGTGGGTGAGAGAGAAGGGGAGG + Intronic
1053421523 9:37982974-37982996 GCTGGAAAAGATGGAGGGGGGGG - Intronic
1053480959 9:38415878-38415900 GGTGGATCAGATAGAGGGGGAGG - Intronic
1055766361 9:79667745-79667767 TGTGGACCAGATTGAGGGTGGGG - Intronic
1056889543 9:90478017-90478039 GGTGGAGAAGATGCAGGGGGTGG + Intergenic
1060374823 9:123108532-123108554 GGTGGAACTGGGAGAGGGGGAGG - Intergenic
1060628977 9:125139006-125139028 GGTGGAGCAGAGGGAGGGTGGGG + Intronic
1060700744 9:125747357-125747379 GGAGGAGAAGAAAGAGGGGGAGG - Intronic
1062331587 9:136047269-136047291 GGGGGAGCAGGTAGAGGGAGGGG - Intronic
1185456233 X:312194-312216 GGTGGATTATGTAGACGGGGTGG + Intronic
1185456252 X:312291-312313 GGTGGATTATGTAGACGGGGTGG + Intronic
1185566740 X:1100403-1100425 GATGGAGGAGATAGAGGAGGAGG + Intergenic
1189600112 X:42615354-42615376 GGAGGATCAGATGGTGGGTGGGG + Intergenic
1190608304 X:52167981-52168003 GGTGGAGCAGATGGAAGGGGAGG - Intergenic
1190832240 X:54069582-54069604 GGTGGTTAAGGTAGAGGGTGGGG - Exonic
1191892246 X:65956305-65956327 AGCCGATCTGATAGAGGGGGAGG - Intergenic
1192340159 X:70257738-70257760 GATGGCTCAGACTGAGGGGGTGG - Intergenic
1193736841 X:85167236-85167258 GGGGAATCAGAGAGATGGGGGGG + Intergenic
1193871731 X:86806296-86806318 GGAGGAAGAGATAGATGGGGAGG + Intronic
1194618474 X:96137492-96137514 GGAGGAAGAGAGAGAGGGGGAGG - Intergenic
1194795506 X:98207364-98207386 GGTGGAGGAGATGGAAGGGGAGG - Intergenic
1195738684 X:108039692-108039714 GGTGGCTCAGATGAAGAGGGGGG + Intergenic
1195989896 X:110672066-110672088 GGAGGAACAGACAGAGGAGGGGG + Intergenic
1197272746 X:124443333-124443355 GATGGATGAGAGAGAGGGGAAGG + Intronic
1197436507 X:126434834-126434856 GGAGGAGGAGATAGAGGAGGGGG + Intergenic
1197856339 X:130917584-130917606 GGTGGATAAGGTAGAGATGGTGG - Intergenic
1198462149 X:136874158-136874180 AGCCGATCTGATAGAGGGGGAGG - Exonic
1199800741 X:151248364-151248386 GCTGGAGCAGAGGGAGGGGGAGG + Intergenic
1200137862 X:153883640-153883662 CGTGGTTCAGACAGTGGGGGAGG - Intronic
1201065576 Y:10091930-10091952 GGGGGAGGAGAGAGAGGGGGAGG + Intergenic
1201452052 Y:14127684-14127706 GGAGGATCAGATGAAGGTGGAGG - Intergenic
1201550196 Y:15210833-15210855 GTTGGAAGAGAGAGAGGGGGAGG + Intergenic