ID: 1053480960

View in Genome Browser
Species Human (GRCh38)
Location 9:38415881-38415903
Sequence GTGGGTGGATCAGATAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480960_1053480967 1 Left 1053480960 9:38415881-38415903 CCCCCTCTATCTGATCCACCCAC 0: 1
1: 0
2: 4
3: 25
4: 278
Right 1053480967 9:38415905-38415927 CATTCAGCTGTACCCATCTGAGG No data
1053480960_1053480972 14 Left 1053480960 9:38415881-38415903 CCCCCTCTATCTGATCCACCCAC 0: 1
1: 0
2: 4
3: 25
4: 278
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480960_1053480970 13 Left 1053480960 9:38415881-38415903 CCCCCTCTATCTGATCCACCCAC 0: 1
1: 0
2: 4
3: 25
4: 278
Right 1053480970 9:38415917-38415939 CCCATCTGAGGGCCCTCTGAAGG No data
1053480960_1053480973 17 Left 1053480960 9:38415881-38415903 CCCCCTCTATCTGATCCACCCAC 0: 1
1: 0
2: 4
3: 25
4: 278
Right 1053480973 9:38415921-38415943 TCTGAGGGCCCTCTGAAGGGTGG No data
1053480960_1053480968 2 Left 1053480960 9:38415881-38415903 CCCCCTCTATCTGATCCACCCAC 0: 1
1: 0
2: 4
3: 25
4: 278
Right 1053480968 9:38415906-38415928 ATTCAGCTGTACCCATCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480960 Original CRISPR GTGGGTGGATCAGATAGAGG GGG (reversed) Intronic
900954678 1:5879158-5879180 GTGGGAGGGGCAGTTAGAGGTGG - Intronic
902706345 1:18207926-18207948 GTGGGAAGATCAGATACAGAAGG + Intronic
903028090 1:20443648-20443670 GTGGGTGGATCAGCTTGGGTTGG - Intergenic
903397655 1:23014209-23014231 GTGGGTGCTTCAGACAAAGGAGG - Intronic
903562171 1:24236344-24236366 GTGGGTGACTCAGAGACAGGCGG - Intergenic
903668324 1:25021359-25021381 GTGGGGAGAGCAGAGAGAGGCGG + Intergenic
904010486 1:27387075-27387097 GTGTGAGGACCAGAGAGAGGAGG - Intergenic
904205986 1:28855543-28855565 GTGGGTGGAGGGGAGAGAGGGGG + Intronic
905310253 1:37043981-37044003 GTGGGTGGAGGAGGAAGAGGAGG + Intergenic
905690039 1:39936405-39936427 GTGGGAGGCTCAGGCAGAGGTGG + Intergenic
905864099 1:41367312-41367334 GTGGGTGCATCAGCTACAGCAGG + Intronic
906283254 1:44568278-44568300 GTGGCTGGAGCAGAGTGAGGTGG - Intronic
906874386 1:49521035-49521057 GTGGGTGGATCATATGAAGTCGG - Intronic
907038597 1:51237481-51237503 ATGGGTGGAGCAAAAAGAGGAGG - Intronic
908709093 1:66995078-66995100 GTGAATGCATCAGATAGAGCAGG - Intergenic
910434261 1:87189404-87189426 GTTGGTGGATCAGAGAGACAAGG - Intergenic
913175532 1:116269593-116269615 TTGGGTGAATAAGAGAGAGGTGG + Intergenic
915351743 1:155231222-155231244 GTGGGTGATTTGGATAGAGGGGG + Intergenic
915497291 1:156291292-156291314 GTGGGGGGAGTAGATAGGGGAGG - Intronic
915802434 1:158808609-158808631 GTGGGAGGAACAGGTAGAGAAGG + Intergenic
916677370 1:167075235-167075257 GTGGGGTGAACAGATAGAAGTGG + Intronic
917139168 1:171817643-171817665 GTGGGTGGGGAAGAAAGAGGAGG + Intergenic
917194950 1:172455326-172455348 GTGTGGGGAACAGAAAGAGGAGG - Intronic
918407095 1:184222303-184222325 GTGGGTGGATTTGGAAGAGGTGG - Intergenic
919387701 1:196941958-196941980 GTGGGTGCAGCACATGGAGGGGG - Intronic
919727542 1:200893937-200893959 GTGGGAAGATCAGAGAGTGGGGG + Intronic
919789236 1:201279630-201279652 GTGAGGGGCTCAGCTAGAGGTGG + Intergenic
920122582 1:203669785-203669807 CTGGATGGAACAGAGAGAGGTGG + Intronic
920507045 1:206522662-206522684 GTGGAGGGAGCAGAAAGAGGTGG - Intronic
1062867282 10:866351-866373 ATGGGTGGATGAGAGAGAAGAGG - Intronic
1063595974 10:7435970-7435992 CAGGGTGGACCAGATGGAGGGGG + Intergenic
1064083536 10:12327677-12327699 CTGTGTGCATCAGATAGATGAGG - Intergenic
1065328954 10:24573828-24573850 GTGGGGGGATCTGATCTAGGTGG + Intergenic
1067473669 10:46552864-46552886 CTGGGAGGATCAGGAAGAGGAGG + Intronic
1068540438 10:58287718-58287740 GAAGGTGAATCAGACAGAGGTGG - Exonic
1069363116 10:67666831-67666853 GCTGTTGGAGCAGATAGAGGAGG - Intronic
1069826946 10:71260331-71260353 GTGGGTGGAGGCGAGAGAGGCGG + Intronic
1070787256 10:79169129-79169151 GAGGGTGGGCCAGATGGAGGTGG - Intronic
1072563149 10:96595587-96595609 CTGGGTGGAACAGGTGGAGGAGG + Exonic
1072945579 10:99807311-99807333 ATGGGTGGATCAGATACACCTGG + Intronic
1073543901 10:104333493-104333515 GTGGGCCTAACAGATAGAGGGGG + Exonic
1075259761 10:120953119-120953141 GTGGGGAGATCAGACAGAGATGG - Intergenic
1076816284 10:132916545-132916567 CTGAGTGGATCACATACAGGTGG - Exonic
1078621028 11:12908205-12908227 GTGCCTGGACCACATAGAGGAGG - Intronic
1080194088 11:29587469-29587491 GTGGGTGGGTCTCATGGAGGTGG + Intergenic
1080762200 11:35262453-35262475 GTGGTTGGAGCAGAGAGAAGTGG - Intronic
1083364405 11:62132807-62132829 GGGGGTGGAGGAGAGAGAGGAGG + Intronic
1083366605 11:62145211-62145233 GCGGGTGGAGCAGATGAAGGAGG + Exonic
1083850405 11:65362718-65362740 CTGTGTGGTTCAGATAAAGGAGG + Intergenic
1083945658 11:65921231-65921253 GTGGGAGGGTCAGATGGGGGAGG + Intronic
1085557742 11:77440833-77440855 GTGGGAGGGGCAGATAGAGGTGG - Intronic
1085557748 11:77440852-77440874 GTGGGAGGAGCAGGTAGAGGTGG - Intronic
1085557753 11:77440871-77440893 GTGGGAGGAGCAGGTAGAGGTGG - Intronic
1085755638 11:79199047-79199069 GTGGGTGGAGCAAAGAGAGGGGG + Intronic
1088910806 11:114190716-114190738 GTGTGTGTATGAGAGAGAGGTGG - Intronic
1089485963 11:118846473-118846495 GTGTGTAGGACAGATAGAGGGGG - Intergenic
1091067875 11:132533778-132533800 GTGGGTGGATCAGATGGCATAGG - Intronic
1091748787 12:3010038-3010060 GTGGGGGGATCAGAGGGAGCAGG - Intronic
1091760546 12:3084445-3084467 GTCGGTGGAGCAGGGAGAGGGGG + Intronic
1092443557 12:8531297-8531319 GTGGGTGGAGCAGAGCAAGGTGG - Intergenic
1095873354 12:47054450-47054472 GTGAGTAGATTAGATGGAGGAGG - Intergenic
1097899762 12:64860663-64860685 ATGGGTGGTTCTGATACAGGTGG + Intronic
1097964042 12:65560198-65560220 GTGGGTAGATAGGATACAGGTGG + Intergenic
1098407512 12:70141684-70141706 GGGGATGGAGCAGATAGAGAGGG + Intergenic
1099541033 12:83907906-83907928 GTGGCTGGAGCAGAGTGAGGTGG + Intergenic
1101247781 12:102901215-102901237 GTCAGTGAATAAGATAGAGGAGG - Intronic
1101579337 12:106027696-106027718 GTGGGTGGATCAGATGGTCAAGG - Intergenic
1102133652 12:110553752-110553774 GTGGGTGGATCAGCAAGACCTGG + Intronic
1102236459 12:111297177-111297199 TTGGGAGGGTCAGAGAGAGGAGG - Intronic
1102899954 12:116628690-116628712 GTGGCTGGAGCAGAGAGAGCCGG - Intergenic
1105483776 13:20805420-20805442 GTGGGTTGAGCAGAATGAGGTGG - Intronic
1106871526 13:34026819-34026841 GTGGATAAACCAGATAGAGGAGG + Intergenic
1109284236 13:60393562-60393584 ATGGGTGAATCAGTTGGAGGAGG - Intergenic
1112550842 13:100418944-100418966 GTGGATGGAGCAGAGAGAAGGGG - Intronic
1112641005 13:101275110-101275132 GTGGGGGCATCAGAAACAGGAGG - Intronic
1114760823 14:25311949-25311971 GTGTATGGAACAGATAAAGGAGG + Intergenic
1115423496 14:33225726-33225748 GTGGGTGGTACAGAAACAGGTGG + Intronic
1115613926 14:35074811-35074833 GTGGGTGGATCACATGGGGCCGG + Intronic
1118138796 14:63056986-63057008 GTGGGTGGAACAGGTAGGGAAGG + Intronic
1118899446 14:69974263-69974285 GTGGGAGGATCAGAGGAAGGAGG + Intronic
1120893413 14:89509080-89509102 GTGGGTGGAACAGAGTGAGAGGG - Intronic
1120964529 14:90155758-90155780 GTGGGTGGATCAGATTGGAGGGG + Intronic
1121483528 14:94296101-94296123 TTGTGTGGATCAGATGAAGGGGG + Intergenic
1124830919 15:33148509-33148531 CTGGTTGGTTCAGTTAGAGGAGG + Intronic
1127347373 15:58114155-58114177 GTGTGTGGACCAGATAGAGAAGG - Intronic
1127826633 15:62709418-62709440 GTGTCTGGGCCAGATAGAGGAGG + Intronic
1128302754 15:66577188-66577210 GTGGGTGGCTCCAATAGAGTTGG - Intergenic
1128805318 15:70526570-70526592 GTGGGTGGCACAGGGAGAGGCGG - Intergenic
1129941100 15:79497070-79497092 GTGGGTGGATCAGTGCAAGGAGG - Intergenic
1130338686 15:82980262-82980284 GTGTATGGACCATATAGAGGGGG - Intronic
1130444431 15:83986796-83986818 GTGGGTGTATCAATTAGAGATGG + Intronic
1131651659 15:94406300-94406322 GTGTGTGTATGAGGTAGAGGTGG + Intronic
1132457523 16:32382-32404 GTGGGTGGATGAGATATGAGTGG - Intergenic
1132976873 16:2715466-2715488 GTGGGTGGAGGGGATGGAGGGGG + Intronic
1133512439 16:6472851-6472873 GTGGGTGGATCAAATAAGGTTGG - Intronic
1133755340 16:8758448-8758470 GTGGCTGGAGCAGAGAGAGTGGG + Intronic
1134075796 16:11290484-11290506 ATGGCTGGAGCAGAGAGAGGTGG + Intronic
1134450676 16:14361490-14361512 GTGGGGGGCTCAGCTAGATGAGG - Intergenic
1134826729 16:17290831-17290853 TTTGGGTGATCAGATAGAGGTGG + Intronic
1136111439 16:28065953-28065975 GTGGGTGGCTCAGTGAGTGGAGG - Intergenic
1137963886 16:52912156-52912178 GTGGATGGATGAGTGAGAGGGGG - Intergenic
1138129377 16:54466718-54466740 GTGAGAGAGTCAGATAGAGGAGG - Intergenic
1138225303 16:55289753-55289775 GTGGGTGACTCAGACAGAGGAGG + Intergenic
1138240434 16:55423335-55423357 TTGGCTGGATCAGCTAGAAGAGG - Intronic
1139754334 16:69131486-69131508 GTGGGTGGAGAAGATGGGGGTGG - Intronic
1141603963 16:85142604-85142626 GTGGGTGGGGCAGGGAGAGGAGG - Intergenic
1142286120 16:89172203-89172225 TTGAGTGGAGCAGAGAGAGGGGG + Intronic
1142350536 16:89577329-89577351 GAGGGTGGAGCAGACAGTGGTGG + Intronic
1142533376 17:597519-597541 GTGGGTGGATCAGCTAGATTAGG + Intronic
1143389458 17:6551787-6551809 GTGGCTGGATCACTCAGAGGAGG - Intronic
1143975040 17:10823379-10823401 GTGGGTGGGTCAGGTAGGGGTGG + Exonic
1145825740 17:27876040-27876062 GTGGGTGGAGAAAATAGGGGTGG - Intronic
1145963221 17:28899635-28899657 GTGGCTGGAACAGAGTGAGGGGG - Intronic
1146119753 17:30181986-30182008 TTGGGAGGCTGAGATAGAGGGGG - Intronic
1147044919 17:37744918-37744940 GTGGGTGGGTGCGAGAGAGGAGG + Exonic
1147418470 17:40310075-40310097 GGGTGTGGACCAGATTGAGGAGG + Intronic
1147920280 17:43912112-43912134 GTGGGTGGCACAGATGGATGTGG - Intergenic
1149555275 17:57569105-57569127 GACGGTGGATTAGAGAGAGGAGG + Intronic
1149966604 17:61170751-61170773 ATGAGTGGAGGAGATAGAGGTGG + Intronic
1150244905 17:63667085-63667107 GTGGGCAGATAAAATAGAGGGGG - Intronic
1150435669 17:65152297-65152319 GTGGCTGGATCAGAGGGAGCCGG + Intronic
1150578498 17:66451678-66451700 GTGGGTGGAGCAGAGGGAGTGGG + Intronic
1151190833 17:72396720-72396742 GTGTGTGGAGCAGATAAAGGAGG - Intergenic
1151376224 17:73690811-73690833 GTGGGTGGAGCCGAGAAAGGAGG - Intergenic
1152303481 17:79508494-79508516 GTGCGGGGAGCAGAGAGAGGAGG - Intronic
1154121885 18:11658775-11658797 CTGGTTGGATTGGATAGAGGAGG - Intergenic
1155877533 18:31104977-31104999 GTGAATGGATCAGAGAGATGTGG - Intergenic
1157307685 18:46528988-46529010 GTGGGTGCATCAGCTAGGAGAGG + Intronic
1157914138 18:51648072-51648094 GTGGCTGGAATAGAAAGAGGTGG - Intergenic
1158220083 18:55141483-55141505 GTGGGTGGATTTCATAGAGTTGG - Intergenic
1158246555 18:55439001-55439023 GTGGGTGGTTCAAATAGAGATGG + Intronic
1159407128 18:68018775-68018797 GTGGGAGGAAGAGATGGAGGAGG - Intergenic
1160408959 18:78661688-78661710 TTGGGTGGAGCAGGAAGAGGAGG + Intergenic
1160720622 19:595549-595571 GTGGGTGGATGAGATGGTGAGGG - Intronic
1160770444 19:828573-828595 TTGGGGGGCTCAGATGGAGGAGG + Intronic
1161226159 19:3146919-3146941 GTGGCTGGAGCAGAGTGAGGAGG - Intronic
1161243052 19:3233654-3233676 GTGGCTGGAGCAGAGTGAGGAGG + Intronic
1161245857 19:3251455-3251477 GTGGCTGGAACAGAGTGAGGAGG + Intronic
1161253089 19:3291726-3291748 GTGGCTGGAGCAGAGTGAGGAGG + Intronic
1161257296 19:3316484-3316506 GTGGCTGGACCAGAGTGAGGAGG + Intergenic
1161257914 19:3320137-3320159 GTGGCTGGAGCAGAGTGAGGAGG + Intergenic
1161623206 19:5310065-5310087 GTGGCTGGAGCAGAGTGAGGAGG - Intronic
1161642951 19:5435716-5435738 GTGGCTGGAGCAGAGTGAGGAGG - Intergenic
1161719744 19:5896217-5896239 GTGGCTGGAGCAGAGTGAGGAGG + Intronic
1161857105 19:6772395-6772417 GGGGCTGGACCAGACAGAGGAGG + Intergenic
1163469445 19:17487941-17487963 GTGGGTGGAGGAGAGAGTGGGGG - Intronic
1163493426 19:17630704-17630726 GTGGCTGGATGAGAATGAGGAGG - Exonic
1163828534 19:19536960-19536982 GAGGCTGGGTCAGATGGAGGAGG + Intronic
1166546218 19:43636051-43636073 GGGGCTGGATCTGATGGAGGAGG - Intronic
1166659909 19:44640034-44640056 GTGGGTGGATCATTTTGAAGGGG - Intergenic
1166927547 19:46279235-46279257 GTGTGAGGGTCAGATAGAGGAGG - Intergenic
1167002401 19:46753738-46753760 GTGGGTGGACCTGGTTGAGGAGG + Intronic
1167007726 19:46786774-46786796 GGGGGTGGCCCAGACAGAGGAGG + Intronic
1167706029 19:51081821-51081843 CTGGGTGGGACAGATAGAGGCGG - Intronic
925606550 2:5666379-5666401 GTGGGTGGAGCACGTGGAGGGGG - Intergenic
928891263 2:36205684-36205706 GTGGGTGGAACATAAAGTGGAGG + Intergenic
932179307 2:69631555-69631577 GTGGGTGAATCAGTTTGAGCTGG - Intronic
937114215 2:119392688-119392710 GTGGGTGGCTTGGATAGAGGAGG - Intergenic
937535061 2:122876104-122876126 GGGGATGGAGAAGATAGAGGAGG - Intergenic
937661077 2:124430230-124430252 GTGGGTGGGTCAGACAGGGTAGG + Intronic
938123156 2:128647793-128647815 GGGGGTGGTTCAGAGAAAGGAGG + Intergenic
938822530 2:134974227-134974249 GTGGGTGGATCACCTAAAGTCGG - Intronic
940493493 2:154394453-154394475 GTGGGTGGATTTAATTGAGGTGG - Intronic
940940081 2:159550067-159550089 GTGGGTGGATCAGGCAGAGGTGG - Intronic
941490989 2:166142052-166142074 GAGGGTGGAGGAGAAAGAGGAGG + Intergenic
941790131 2:169543233-169543255 GTGGGTGGATCACCTAAAGTCGG + Intronic
943047088 2:182872313-182872335 GTGGGTGGATTAGATTGTTGAGG - Intergenic
943486651 2:188493672-188493694 GTTTCTGGCTCAGATAGAGGAGG - Intronic
944214066 2:197236334-197236356 GTGGGTGGTTCAGATACTTGTGG - Intronic
946172171 2:217902081-217902103 GTGGGGGGATTAGACAGGGGTGG + Intronic
946883711 2:224201960-224201982 GTGGCTGGAACAGAAGGAGGTGG - Intergenic
947999476 2:234555951-234555973 GTGAGTGGATCAGATGGTGGAGG - Intergenic
948477008 2:238226812-238226834 GTTGGAGGATGAGACAGAGGAGG - Intronic
948765661 2:240217481-240217503 GTGGGTGGAGCCGGTGGAGGTGG - Intergenic
948765687 2:240217574-240217596 GTGGGTGGAGCTGAAAGAGTGGG - Intergenic
1170632752 20:18079533-18079555 GTGGCTGGAGCAGCTAGAGCTGG - Intergenic
1171177211 20:23061486-23061508 GTGGGTGGACCAGCTATGGGTGG - Intergenic
1171780270 20:29411055-29411077 GTGGGTGAACTCGATAGAGGAGG + Intergenic
1171824234 20:29879319-29879341 GTGGGTGAACTGGATAGAGGAGG + Intergenic
1172646257 20:36471995-36472017 GTCGGTAGATCCGAGAGAGGTGG + Intronic
1174003646 20:47392986-47393008 GTGGGTGGTTAAGCTAGAGTGGG + Intergenic
1174062082 20:47839900-47839922 GTGGATGGGCCAGAAAGAGGGGG + Intergenic
1175300217 20:57937772-57937794 GTGGATGGATCAGATGTTGGGGG + Intergenic
1175651221 20:60725446-60725468 GTGGGAGGATCAGGTAGAAGTGG - Intergenic
1176176693 20:63730402-63730424 GTGGGTGGAGCAGAGTGAGGTGG - Intronic
1176293017 21:5056149-5056171 GTGTGTGGTTCAGCTCGAGGAGG + Intergenic
1176951340 21:15050832-15050854 GTGTATGGGTCAGGTAGAGGAGG - Intronic
1177019511 21:15836753-15836775 GTGTGTGGATCAGAGTGAGTAGG + Intronic
1177019519 21:15836835-15836857 GTGTGTGGATCAGAATGAGTAGG + Intronic
1177019536 21:15836999-15837021 GTGTGTGGATCAGAGTGAGTAGG + Intronic
1177019544 21:15837081-15837103 GTGTGTGGATCAGAGTGAGTAGG + Intronic
1177019552 21:15837163-15837185 GTGTGTGGATCAGAGTGAGTAGG + Intronic
1177019560 21:15837245-15837267 GTGTGTGGATCAGAGTGAGTAGG + Intronic
1177019568 21:15837327-15837349 GTGTGTGGATCAGAGTGAGTAGG + Intronic
1179864243 21:44207501-44207523 GTGTGTGGTTCAGCTCGAGGAGG - Intergenic
1181858052 22:25796908-25796930 GGAGGTGGGTCAGATAGAGATGG - Intronic
1181960092 22:26616570-26616592 GAGGGTGGAACAGCTAGTGGAGG - Intronic
1182143665 22:27983620-27983642 GAGGGTGGATCAGAGGGTGGAGG - Exonic
1184244780 22:43230435-43230457 GGGGGTGGAAAAGATACAGGTGG + Intronic
1184978578 22:48080470-48080492 GTGGGGGGATGAGTAAGAGGTGG - Intergenic
1185234337 22:49703467-49703489 GTGGGGAGATCAGAGACAGGCGG - Intergenic
952585987 3:34892858-34892880 GTGGGAAGATGAGATAGAGGGGG + Intergenic
952906714 3:38143852-38143874 GTGTGAGGGTCAGATAGGGGTGG - Intergenic
953108244 3:39907006-39907028 CTGTGTGACTCAGATAGAGGAGG + Intronic
955541090 3:59977002-59977024 GTGGGTGGATCAGGCAGTGGGGG + Intronic
960322630 3:116255127-116255149 ATGGGTGGATCAAGAAGAGGAGG - Intronic
961146540 3:124598609-124598631 GTGTGTGAATGAGACAGAGGGGG - Intronic
961901816 3:130220327-130220349 GTGACTGGGTCAGATAAAGGAGG + Intergenic
962642693 3:137404283-137404305 GTGGGTTGCTCTGGTAGAGGAGG - Intergenic
964569490 3:158095793-158095815 CTGGGTGGATAAAATGGAGGGGG + Intergenic
966892762 3:184419097-184419119 GTGTTTGGAACAGAGAGAGGAGG - Intronic
967845235 3:194037664-194037686 GTGGGTGGAGTAGACAGAAGAGG + Intergenic
968226501 3:196975675-196975697 GGGGGTGGAGCAGATTTAGGGGG + Intergenic
968359350 3:198136625-198136647 GTTGGTGGCTCAGATAGAGGTGG + Intergenic
969618044 4:8265137-8265159 GTGTGTGTTTCAGATAGAGACGG + Intergenic
970319787 4:14863634-14863656 GTGGGTGGATCAGAAAGAACCGG - Intergenic
974911114 4:68121090-68121112 CTGGGTGGGTCATATAGAAGGGG - Intronic
975650942 4:76592228-76592250 GTGGGTGGAGCAGAATGTGGCGG + Intronic
976397558 4:84572499-84572521 GTGGGTGGAGCAGAGAGGGTAGG + Intergenic
978464120 4:108989152-108989174 GGGACTGGATCAGTTAGAGGAGG + Intronic
978503079 4:109430230-109430252 GTAAATGGATCAGATAAAGGAGG + Intergenic
978737494 4:112100425-112100447 GTGGGTGGAACAGGGAGTGGGGG + Intergenic
980085750 4:128388138-128388160 GTGGATGATTCAGATAGAGATGG + Intergenic
982064346 4:151639885-151639907 GTGGGTGGAGCTGAGAGTGGGGG + Intronic
983815150 4:172116496-172116518 GTGGGTGGATCACTGAGACGAGG - Intronic
984334639 4:178374917-178374939 GTAGGTGGATCAGGTATATGTGG - Intergenic
985369045 4:189265737-189265759 GTGGCTGGAGCAGAGAGAGGAGG - Intergenic
985879803 5:2629676-2629698 GCGGGTGGATCAGTTAGGGCAGG - Intergenic
989134874 5:38143857-38143879 GTGGCTGGGCCAAATAGAGGAGG - Intergenic
989234013 5:39123240-39123262 GAGGGTGGAGGACATAGAGGGGG - Intronic
992010207 5:72518385-72518407 CTGGGTGGAGGAGAGAGAGGAGG - Intergenic
992314989 5:75543425-75543447 GTGGGTGTATGAGAAAGAGAGGG + Intronic
992315492 5:75549249-75549271 GAGGGAGGATCAGATAGATAGGG - Intronic
992710258 5:79446153-79446175 ATGTATGGATCAGATAGAGGAGG - Intronic
993507294 5:88725555-88725577 GTGGGTGGGTGATAAAGAGGTGG + Intronic
995200777 5:109423240-109423262 ATGGGTGGATGATATAAAGGAGG - Intergenic
996244167 5:121239619-121239641 GAGAGTGGATCAGATACAGGTGG - Intergenic
997390603 5:133511842-133511864 GTGGGTGGAGCAGGCAGAAGGGG + Intronic
999480170 5:151940916-151940938 GGAGGTGGATCATAAAGAGGAGG + Intergenic
999698704 5:154208357-154208379 GTGGGAGGGGCAGGTAGAGGTGG - Intronic
1000203284 5:159032975-159032997 GAGGGTGGAGAAGGTAGAGGAGG - Intronic
1001799563 5:174531080-174531102 GTGTCTGGATTAGATACAGGTGG + Intergenic
1004019179 6:11761020-11761042 ATGGCTGGTTCAGATTGAGGAGG - Intronic
1006551019 6:34823256-34823278 GTGTCTGGATAAGGTAGAGGTGG + Exonic
1006924719 6:37648099-37648121 ATGGGTGGGTCAGAAAGGGGTGG - Intronic
1010923612 6:81716062-81716084 GTCAGTGGCTCAGATAGAAGAGG - Intronic
1012355471 6:98308742-98308764 GTGGGTGAATCATATGGAGGCGG - Intergenic
1013091447 6:106904386-106904408 GTGGGTAGAGCAGATTGTGGAGG - Intergenic
1013929645 6:115515967-115515989 GTGGGTGGATCCCACAGAGACGG + Intergenic
1014807850 6:125851163-125851185 GTGGATGAATCATATAGTGGTGG + Intronic
1015713832 6:136170168-136170190 ATGGGTGGCTCAGATACAGTAGG + Intronic
1016358970 6:143247873-143247895 CTGGGTGGATCTGATTCAGGAGG + Intronic
1017053339 6:150414785-150414807 GTGGTTGCCTCAGAAAGAGGAGG - Intergenic
1019260645 7:80051-80073 GTTGGTGGCTCAGATAGAGGTGG - Intergenic
1019346093 7:531571-531593 GGGGGTGAAACAGAGAGAGGAGG + Intergenic
1019707573 7:2503826-2503848 GTGGGAGGATCAGCTGGGGGTGG - Intergenic
1023144156 7:37132626-37132648 GTGGGTGGAGCAGAAGGAAGTGG - Intronic
1023146962 7:37160851-37160873 GTGGGAGGAGCAGACATAGGGGG + Intronic
1024028819 7:45438256-45438278 GTGGGTGGGTGAGATTTAGGCGG + Intergenic
1024859626 7:53823587-53823609 CTGGGTGGATTGGATACAGGAGG + Intergenic
1025232370 7:57211266-57211288 GTGGATGGGCCAGAAAGAGGGGG - Intergenic
1031074416 7:117199145-117199167 GTGAGTGGAAGAGAGAGAGGTGG + Intronic
1032278860 7:130485276-130485298 GGGGGTGGGTAAGATGGAGGTGG + Intergenic
1033722349 7:144074926-144074948 GTGGGAGGAGCAGATGGAGAAGG - Exonic
1033724225 7:144095814-144095836 GTGGGAGGAGCAGGTAGAGAAGG - Exonic
1033725931 7:144118665-144118687 GTGGGAGGAGCAGGTAGAGAAGG + Intergenic
1034276847 7:149827615-149827637 GTGGGTGGATAAGAAAGATCAGG + Intergenic
1034576730 7:152006189-152006211 GTGGCTGGATCAGCGAGAGAAGG + Intronic
1035032486 7:155870516-155870538 CTTGGAGGATCAGATGGAGGAGG - Intergenic
1037177848 8:15967724-15967746 CTGGGTGGGTCAGAAAGAAGTGG - Intergenic
1037259484 8:16991619-16991641 TGGGGTGGTCCAGATAGAGGTGG - Intergenic
1037762787 8:21752926-21752948 GTCGGTGGCTCAGATCCAGGTGG - Intronic
1038849939 8:31265951-31265973 GTAGGTGACTCAAATAGAGGTGG - Intergenic
1041625845 8:60025758-60025780 GTGGCTGGAGCAGAGGGAGGAGG - Intergenic
1043220995 8:77663544-77663566 TTGGGTTGATCAGGTATAGGGGG - Intergenic
1043304990 8:78783001-78783023 TTGGGTGGTTCAGATCCAGGAGG - Intronic
1044088748 8:87973117-87973139 GTGGTTGCATCAGAAAGAGAAGG + Intergenic
1044344999 8:91095099-91095121 GTGTATGGGTCAGACAGAGGAGG - Intergenic
1046365725 8:113228630-113228652 GTGGGAGGATTAGAAGGAGGAGG - Intronic
1048028236 8:130606485-130606507 GTGGGTGGATAACAGAGATGGGG - Intergenic
1049889430 9:54841-54863 GTGGCTGGAACAGAAGGAGGAGG - Intergenic
1052154783 9:25172059-25172081 GTGTGTGTATCAGAGAGAGAGGG - Intergenic
1053480960 9:38415881-38415903 GTGGGTGGATCAGATAGAGGGGG - Intronic
1054337405 9:63818455-63818477 GTAGGTGAACCCGATAGAGGAGG + Intergenic
1054456479 9:65434001-65434023 GTGGGTGGGGCAGGTGGAGGTGG - Intergenic
1055858126 9:80716716-80716738 GGGGGTGGATAAGATTGAGATGG + Intergenic
1056429695 9:86514960-86514982 GTGGGTGCATGAGAATGAGGGGG - Intergenic
1059075819 9:111192944-111192966 GTGGTAGGATCAGATACAGCAGG - Intergenic
1061485141 9:130916756-130916778 GTGGGTGGGGCAGAAAGAAGGGG - Intronic
1062043794 9:134416010-134416032 GTGGATGGAACAGAAGGAGGTGG + Intronic
1062501542 9:136854085-136854107 GGGGGTGGAACAGGAAGAGGCGG - Intronic
1062744038 9:138200339-138200361 GTTGGTGGCTCAGATAGAGGTGG + Intergenic
1203377302 Un_KI270442v1:385764-385786 GTGGGTGAACTCGATAGAGGAGG + Intergenic
1186256976 X:7732597-7732619 GTGGGTGGGACAGAGAGTGGGGG - Intergenic
1186672236 X:11779723-11779745 GTGGCTGGAGCAGAGTGAGGAGG + Intergenic
1187483725 X:19682090-19682112 GTGGGTAGAGCAGTTGGAGGAGG + Intronic
1189435292 X:40987574-40987596 GTGCATGGGCCAGATAGAGGAGG - Intergenic
1190216092 X:48480401-48480423 GTGGTTGGAACAGAGTGAGGGGG + Intronic
1192340160 X:70257741-70257763 GTGGATGGCTCAGACTGAGGGGG - Intergenic
1193808514 X:86022970-86022992 GGTGGTGGATCAGATAAAGTAGG - Intronic
1195160223 X:102163533-102163555 GTGGGAGGAAGAGAGAGAGGAGG + Intergenic
1195306374 X:103586928-103586950 GAGGGAGGATCAGAGAGAGAGGG + Exonic
1196996923 X:121394304-121394326 GTGAGTGGTTCACAAAGAGGGGG + Intergenic
1198019894 X:132647306-132647328 AGGGGTGGAGAAGATAGAGGGGG - Intronic
1198276022 X:135097211-135097233 GTGGGCAGAGCAGATGGAGGAGG - Intergenic
1198310491 X:135423521-135423543 GTGGGCAGAGCAGATGGAGGAGG + Intergenic
1199033510 X:143027543-143027565 GTGGGTGGATCTGATAGACTGGG + Intronic
1200398833 X:156006999-156007021 GTGGGTGGATGAGATATGAGTGG + Intronic