ID: 1053480961

View in Genome Browser
Species Human (GRCh38)
Location 9:38415882-38415904
Sequence AGTGGGTGGATCAGATAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480961_1053480973 16 Left 1053480961 9:38415882-38415904 CCCCTCTATCTGATCCACCCACT 0: 1
1: 0
2: 1
3: 12
4: 198
Right 1053480973 9:38415921-38415943 TCTGAGGGCCCTCTGAAGGGTGG No data
1053480961_1053480968 1 Left 1053480961 9:38415882-38415904 CCCCTCTATCTGATCCACCCACT 0: 1
1: 0
2: 1
3: 12
4: 198
Right 1053480968 9:38415906-38415928 ATTCAGCTGTACCCATCTGAGGG No data
1053480961_1053480970 12 Left 1053480961 9:38415882-38415904 CCCCTCTATCTGATCCACCCACT 0: 1
1: 0
2: 1
3: 12
4: 198
Right 1053480970 9:38415917-38415939 CCCATCTGAGGGCCCTCTGAAGG No data
1053480961_1053480967 0 Left 1053480961 9:38415882-38415904 CCCCTCTATCTGATCCACCCACT 0: 1
1: 0
2: 1
3: 12
4: 198
Right 1053480967 9:38415905-38415927 CATTCAGCTGTACCCATCTGAGG No data
1053480961_1053480972 13 Left 1053480961 9:38415882-38415904 CCCCTCTATCTGATCCACCCACT 0: 1
1: 0
2: 1
3: 12
4: 198
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480961 Original CRISPR AGTGGGTGGATCAGATAGAG GGG (reversed) Intronic
900076480 1:821732-821754 AGAGGGTGGATCAGTTGGATAGG - Intergenic
900133097 1:1098296-1098318 GGTGGGTGGATCAGAAGGACAGG - Intronic
900943740 1:5817647-5817669 AGACGGTGGAGCAGATGGAGAGG - Intergenic
902821317 1:18945073-18945095 AGAGGGTGTTCCAGATAGAGAGG - Intronic
903009732 1:20321048-20321070 AGAGGGTAGATCACATAGAAGGG + Intronic
904489488 1:30849653-30849675 AGTGGGAGAATCAGAGACAGGGG - Intergenic
906941501 1:50259797-50259819 AATGGGTGGATGGGGTAGAGAGG - Intergenic
911231141 1:95362893-95362915 TGTGGGTGGAGCAGATTGATTGG + Intergenic
917256611 1:173123084-173123106 AGTGGGTGGAACTGTCAGAGGGG - Intergenic
919387702 1:196941959-196941981 AGTGGGTGCAGCACATGGAGGGG - Intronic
921813077 1:219536488-219536510 AGAAGTGGGATCAGATAGAGTGG - Intergenic
1063024420 10:2163998-2164020 AGTGGGAGCATGAGAAAGAGTGG - Intergenic
1063595973 10:7435969-7435991 ACAGGGTGGACCAGATGGAGGGG + Intergenic
1063900991 10:10732428-10732450 AGTGGGTTGCTCAGAGGGAGAGG - Intergenic
1067392324 10:45875071-45875093 AGTGGGTAGATAAAATAGATTGG - Intergenic
1067870960 10:49960990-49961012 AGTGGGTAGATAAAATAGATTGG + Intronic
1068631019 10:59297728-59297750 AGGGAGTGAATGAGATAGAGGGG - Intronic
1069759637 10:70799738-70799760 AGGGGATGGAGCAGATGGAGAGG + Intergenic
1071153675 10:82665442-82665464 AGTGGGTGGATATGATGAAGTGG - Intronic
1073146589 10:101285505-101285527 AAAGGGTGGACCAGAGAGAGGGG + Intergenic
1073891763 10:108110842-108110864 AGTGGGTGAATGATAGAGAGTGG - Intergenic
1074688346 10:115980198-115980220 TGTGGTTGGATCAGAGGGAGAGG + Intergenic
1075668630 10:124248071-124248093 AGTGAGTGGGTGAGAGAGAGAGG + Intergenic
1076564108 10:131386560-131386582 AGAGGGAGGAGCAGAGAGAGGGG + Intergenic
1077279620 11:1736696-1736718 AGTGGGTGGAATGGATGGAGTGG + Intronic
1077279626 11:1736719-1736741 AGTGGGTGGAATGGATGGAGTGG + Intronic
1077279639 11:1736797-1736819 AGTGAATGGAACGGATAGAGTGG + Intronic
1079231627 11:18654204-18654226 AGTGGGTGGATCACAAAGTCAGG - Intergenic
1079664983 11:23093658-23093680 GGTGGGTGGAGAAGACAGAGAGG - Intergenic
1081517637 11:43848880-43848902 TGATGGTGGCTCAGATAGAGTGG - Intronic
1083966849 11:66048675-66048697 CGGGGGTGGATGAGAGAGAGAGG - Intronic
1085055958 11:73403945-73403967 TGTGTGGGGATCAGATGGAGGGG + Intronic
1085130934 11:74037832-74037854 AGTTGGTGGATTGGAGAGAGAGG - Intronic
1085755637 11:79199046-79199068 TGTGGGTGGAGCAAAGAGAGGGG + Intronic
1086590788 11:88511341-88511363 AGTGGGTTTCTCAGACAGAGTGG - Intronic
1087680530 11:101214321-101214343 AGTAGGTGAATCAGTTTGAGGGG + Intergenic
1089285788 11:117407198-117407220 AGGGGCTGGAACAGACAGAGGGG + Intronic
1089292230 11:117444275-117444297 AGAGCGTGGATCAGTTAAAGAGG - Intronic
1089381862 11:118038948-118038970 AGGGGGTGGAGCAGAGAGTGGGG + Intergenic
1090313219 11:125761796-125761818 AGTGGGTGTGTGAGACAGAGAGG + Intergenic
1091760545 12:3084444-3084466 AGTCGGTGGAGCAGGGAGAGGGG + Intronic
1098407511 12:70141683-70141705 GGGGGATGGAGCAGATAGAGAGG + Intergenic
1102572988 12:113838902-113838924 AGTGGCCAGAGCAGATAGAGTGG - Intronic
1102816528 12:115870469-115870491 TGTGGGTGGATTTGGTAGAGGGG - Intergenic
1103445979 12:120995506-120995528 AGTGAGTGGATGAAGTAGAGTGG - Intronic
1105443617 13:20434962-20434984 TCTGGGAGGATGAGATAGAGGGG - Intronic
1106133253 13:26956585-26956607 ATAGGGTGGATAAGATAGGGCGG - Intergenic
1107312019 13:39089599-39089621 AGTGGCTGGAGCAAACAGAGAGG + Intergenic
1107334477 13:39339576-39339598 AGTGGGAGGATCTGACATAGGGG - Intergenic
1110250029 13:73371127-73371149 TGTGGGAGGAAGAGATAGAGAGG - Intergenic
1111943733 13:94641422-94641444 AGTGGCTGGATCTGAGAGAGGGG - Intergenic
1118466427 14:66035156-66035178 AGTTGGTGGATAAGGCAGAGGGG + Intergenic
1119652745 14:76395122-76395144 AGTGGGAGGAGGAGATAGAGAGG + Intronic
1120893414 14:89509081-89509103 GGTGGGTGGAACAGAGTGAGAGG - Intronic
1120964528 14:90155757-90155779 TGTGGGTGGATCAGATTGGAGGG + Intronic
1123663116 15:22583281-22583303 AGTGGGAGGTTCAGATTGAAAGG - Intergenic
1124068490 15:26369025-26369047 AGGAGGTGGAGCAGGTAGAGAGG - Intergenic
1124316918 15:28677584-28677606 AGTGGGAGGTTCAGATTGAAAGG - Intergenic
1126747700 15:51843199-51843221 AGCGTGTGGATAAGATAGAGAGG + Intronic
1131497004 15:92921241-92921263 AGTGGGTGCAGGAGCTAGAGGGG + Intronic
1132670483 16:1100444-1100466 AGTGGGTGGTTGAGGCAGAGGGG + Intergenic
1132976872 16:2715465-2715487 AGTGGGTGGAGGGGATGGAGGGG + Intronic
1133755339 16:8758447-8758469 TGTGGCTGGAGCAGAGAGAGTGG + Intronic
1133890892 16:9877702-9877724 AGGGAGTGGAAGAGATAGAGAGG - Intronic
1133987048 16:10676533-10676555 AGTGAGTGGGTCAAAGAGAGGGG + Intronic
1135816913 16:25643081-25643103 AGTGGGTGGCTGAGATACAAAGG - Intergenic
1136620147 16:31423247-31423269 AGTTGGTGGAGAAGATGGAGAGG + Intronic
1138593331 16:58015416-58015438 AGTGAGTGCATCAGACAGGGAGG - Intronic
1142421477 16:89972963-89972985 AGTGGGTGGAAGAGGTAGCGAGG - Intergenic
1143051851 17:4132601-4132623 AGTGGGTGGATCACAAAGTCGGG + Intronic
1143121337 17:4608998-4609020 AGTGGGAGAATCCGAGAGAGAGG - Intergenic
1147455541 17:40535988-40536010 AGTGGGTGGGGAAGAGAGAGTGG + Intergenic
1148050217 17:44766485-44766507 AGTGGGTGGGCCAGCCAGAGAGG + Intronic
1148913973 17:50959004-50959026 AGTGGGTAGAGCAGATAAAAAGG - Intergenic
1149304601 17:55335649-55335671 AGTGGGAGAATGAGAGAGAGTGG - Intergenic
1150578497 17:66451677-66451699 GGTGGGTGGAGCAGAGGGAGTGG + Intronic
1150989252 17:70236867-70236889 AGTAGGGAGATCAGAAAGAGTGG + Intergenic
1152365645 17:79854841-79854863 AGTGGGGGGACCAGATAACGGGG + Intergenic
1157804084 18:50645069-50645091 AGTGGGTGGCTGGGAGAGAGTGG + Intronic
1160293619 18:77617772-77617794 ACTGGGTGAAACAGAGAGAGTGG - Intergenic
1160479702 18:79227430-79227452 AGTGGGTGAATCGGATGGATGGG + Intronic
1160587938 18:79922995-79923017 AGAGGGTGGAGCAGGAAGAGAGG - Intronic
1160720623 19:595550-595572 TGTGGGTGGATGAGATGGTGAGG - Intronic
1162031841 19:7920856-7920878 AGTGGGTGGGTGAGTTTGAGGGG + Intronic
1164507842 19:28874167-28874189 AGGGGGTGGAAGAGATGGAGGGG + Intergenic
1164650855 19:29890422-29890444 GGTGGGTGGATGGGATAGATGGG - Intergenic
1165010054 19:32839323-32839345 AGTGGGTGGATCACAAAGTCAGG + Intronic
1166095003 19:40532749-40532771 AGTGGCTGGAGAAGATCGAGCGG + Exonic
1167461369 19:49626176-49626198 AGTGGGAGGGGCAGAGAGAGGGG - Exonic
1168688989 19:58365746-58365768 GGTGTGTGGACCAGGTAGAGGGG - Intergenic
925301029 2:2812600-2812622 AGTGGGGGTATGAGAAAGAGAGG - Intergenic
925348614 2:3186988-3187010 GGTGAGTGGATCAGGTAGGGAGG - Intergenic
925606551 2:5666380-5666402 AGTGGGTGGAGCACGTGGAGGGG - Intergenic
928456149 2:31424348-31424370 AGTGGGAGCAACAGAGAGAGAGG - Intergenic
929862935 2:45694682-45694704 GGTGGGTGGATTGGATAGATGGG + Intronic
933616306 2:84485549-84485571 AGTGGGTGGAACCTATAGAGGGG + Intergenic
939128713 2:138207625-138207647 AGAGAGTGGATGAGAAAGAGAGG - Intergenic
942145491 2:173022564-173022586 TGTGGATGGATCAGAGAGTGTGG - Intronic
944053311 2:195496013-195496035 AGTGGCTGGAGCAGAGTGAGTGG - Intergenic
945198259 2:207257299-207257321 AGTGGGTGCAGCAGGTAGAAGGG + Intergenic
945372208 2:209033028-209033050 AATGGGAGGACCAGATAAAGGGG - Intergenic
946701309 2:222417094-222417116 AGTGGGTGGCTCTGATAGCAAGG - Intergenic
946878746 2:224156884-224156906 AGTGGGAGGATGAGATAGCAAGG + Intergenic
947216151 2:227752053-227752075 AGTGGGTGGAGGAGGCAGAGAGG + Intergenic
948765688 2:240217575-240217597 GGTGGGTGGAGCTGAAAGAGTGG - Intergenic
1169074004 20:2750559-2750581 AGTGGGTGGCTCAGCTGGGGCGG - Intronic
1169682222 20:8228300-8228322 AGTGGGTGTATGAGATAGTGGGG - Intronic
1169822201 20:9723794-9723816 AGTGGGTGGACTAGATAGCTCGG - Intronic
1173326293 20:42036715-42036737 AGTGGCTGGTTCAGCCAGAGAGG + Intergenic
1174003645 20:47392985-47393007 TGTGGGTGGTTAAGCTAGAGTGG + Intergenic
1177904470 21:26958881-26958903 AGTGAGTGGATCTGATAGCCTGG + Intronic
1180872107 22:19151992-19152014 AGAGCGTGGAGCAGAGAGAGAGG - Intergenic
1180883082 22:19220290-19220312 AGTGGCTGTATCAGACAGAATGG - Intronic
1181377767 22:22473985-22474007 AGTGGGTGGATCACAAAGTCAGG + Intergenic
1182519812 22:30878932-30878954 ATTGGGGGCACCAGATAGAGTGG + Intronic
950333163 3:12173361-12173383 AGTGGGTGGATGTGATAGCAGGG - Intronic
952142339 3:30494050-30494072 AGTGAGTGGATGAAATACAGAGG + Intergenic
952585986 3:34892857-34892879 GGTGGGAAGATGAGATAGAGGGG + Intergenic
953752759 3:45621833-45621855 AGTGGGTGGATCAAAAAGTCAGG + Intronic
954466021 3:50655363-50655385 GGTGGGTGGCTCAGTTAGACAGG - Intergenic
955541089 3:59977001-59977023 GGTGGGTGGATCAGGCAGTGGGG + Intronic
956610547 3:71117982-71118004 AGTGGGTGGGTCAGGGGGAGTGG + Intronic
958821620 3:98980370-98980392 TTTGGGTAGATCAGAAAGAGTGG + Intergenic
958899096 3:99864639-99864661 AGTGGGTGGAGCAGAAAGCATGG - Intronic
960853742 3:122081673-122081695 AGTGGGAGTATCAGAATGAGTGG + Intronic
961485980 3:127216817-127216839 AGTGGGTGGTTGAGATAGTTTGG - Intergenic
961954377 3:130786504-130786526 ATTGGGTGGATGAGCCAGAGAGG - Intergenic
964284574 3:155103435-155103457 AGAAGATGGATCAGATAGAAAGG - Intronic
964549645 3:157872687-157872709 AGTGGGTGGCAGAGAGAGAGAGG - Intergenic
967347266 3:188471505-188471527 AGTGGGTGGTTAAGATAAAAAGG + Intronic
968226500 3:196975674-196975696 AGGGGGTGGAGCAGATTTAGGGG + Intergenic
968895345 4:3397611-3397633 GGTGGGAGGAGCAGATAGGGGGG + Intronic
969262368 4:6042207-6042229 AGTGGCTGAAGCAAATAGAGGGG - Exonic
972589935 4:40475884-40475906 AGTGGGTGGTACAGAAAGAAGGG + Intronic
973657832 4:53068444-53068466 AGAGGGAGAATAAGATAGAGAGG + Intronic
974140730 4:57883217-57883239 GGAGGGTGGATGGGATAGAGAGG + Intergenic
974911115 4:68121091-68121113 ACTGGGTGGGTCATATAGAAGGG - Intronic
975268936 4:72406126-72406148 AGTGAGTGGATCATATAGGCTGG + Intronic
975668009 4:76753199-76753221 AGGGGTTGCATCAGAGAGAGAGG + Intronic
978084698 4:104636363-104636385 AGTGGTTGGATCAGAATGTGGGG - Intergenic
978737493 4:112100424-112100446 AGTGGGTGGAACAGGGAGTGGGG + Intergenic
979267463 4:118720070-118720092 AGCGGGTGGATCACAGAAAGGGG - Intergenic
980901547 4:138909876-138909898 AGTGTATGGATGAGAGAGAGAGG - Intergenic
980938229 4:139246745-139246767 AGTGAGTGGTTCACTTAGAGTGG + Intergenic
981428529 4:144633171-144633193 AGTGGAGGGATGAAATAGAGAGG + Intergenic
983242385 4:165248165-165248187 AGTGGGTAGTTGAGAAAGAGTGG + Intronic
986281068 5:6322989-6323011 AATGGGTGGAGCAGAGAGATTGG + Intergenic
987681528 5:21143025-21143047 AGTGGGTGGGTCAGAGATGGAGG + Intergenic
987726479 5:21707073-21707095 AGTGAGTGGCTGAGGTAGAGTGG - Intergenic
987979685 5:25066698-25066720 AGTTGGTGAATCAGAAATAGTGG - Intergenic
988103459 5:26711765-26711787 AGGGGGTGGATCAGACAGCCTGG + Intergenic
990261561 5:54028469-54028491 AGGGGGTGGACCAGGTTGAGGGG + Intronic
990819059 5:59817042-59817064 AGTGGGGAGAGCAGATGGAGAGG - Intronic
992314988 5:75543424-75543446 TGTGGGTGTATGAGAAAGAGAGG + Intronic
992315493 5:75549250-75549272 AGAGGGAGGATCAGATAGATAGG - Intronic
993032235 5:82717991-82718013 AGTAGGAGGATGAGAGAGAGCGG - Intergenic
993957011 5:94246474-94246496 AGTGGGTGGGTCAGGTGGGGTGG + Intronic
996585516 5:125083597-125083619 AATGTGGGGAGCAGATAGAGTGG + Intergenic
996730388 5:126712030-126712052 AGTGGGTGGATCACAAAGTCAGG + Intergenic
1000034544 5:157434867-157434889 AGTGGGAGGAAGAGAGAGAGAGG + Intronic
1001036486 5:168300367-168300389 AGGGGGTGGAGCAGAGAGTGGGG + Intronic
1006220775 6:32488767-32488789 AATGGGTGAAACAGATGGAGAGG + Intergenic
1006859616 6:37162034-37162056 GGTGGGTGGATCACAAAGTGAGG + Intergenic
1008968687 6:57341222-57341244 AGTGGGGGGATAGGATGGAGAGG + Intronic
1009157670 6:60243040-60243062 AGTGGGGGGATGGGATGGAGAGG + Intergenic
1011110837 6:83835284-83835306 AGTGGTTGGAAGATATAGAGGGG + Intergenic
1011282701 6:85692417-85692439 AGTGGATGGTTGAGATAGAGTGG + Intergenic
1013316393 6:108947208-108947230 GGTGAGGGGATGAGATAGAGAGG + Intronic
1013327786 6:109064679-109064701 AGTGGGTGGGAGAGAGAGAGAGG + Intronic
1015563430 6:134540850-134540872 ATTGGGTGGAGCAGATAGAAAGG - Intergenic
1016607145 6:145943173-145943195 AGTGGGTGGATGAGATCAACAGG - Exonic
1028433817 7:90778626-90778648 TGTGGGTGGAAGAGCTAGAGAGG - Intronic
1028574250 7:92329194-92329216 AGGGGGTGGATCACCTAGATTGG - Intronic
1030069593 7:105687483-105687505 AGAGGGTGGATCACATGAAGAGG + Intronic
1031367828 7:120924938-120924960 AGTAGATGGATCAAACAGAGGGG - Intergenic
1033271773 7:139938608-139938630 AGTGGCTGGATGTGATAAAGGGG - Intronic
1034685846 7:152970677-152970699 AGTGGGCAGATCAGCAAGAGAGG - Intergenic
1034902961 7:154919070-154919092 AGTGGGTGCCTCAGCTAGAGAGG - Intergenic
1035671630 8:1422580-1422602 TGTGGGTGGAACAGACAGGGTGG + Intergenic
1037594514 8:20343710-20343732 AGTGGCTGGATCACAGGGAGAGG - Intergenic
1037923765 8:22828859-22828881 AGTCGATGGTTGAGATAGAGAGG - Intronic
1040079818 8:43275047-43275069 AGTGGGAGGAGGAGAGAGAGGGG - Intergenic
1040666869 8:49643924-49643946 AGTGGGTGCATTAGATAGAGTGG + Intergenic
1041100932 8:54396033-54396055 AGTTGGTGCTTCAGACAGAGAGG + Intergenic
1043462048 8:80470078-80470100 AAGGGGTGGGTCAGATAGTGTGG - Intergenic
1044425751 8:92047852-92047874 AGTGGGTAGATAAGATTAAGTGG - Intronic
1046048396 8:108989862-108989884 AGTAGGTGGATCAGAGAAAAAGG + Intergenic
1048028237 8:130606486-130606508 AGTGGGTGGATAACAGAGATGGG - Intergenic
1052154784 9:25172060-25172082 TGTGTGTGTATCAGAGAGAGAGG - Intergenic
1053480961 9:38415882-38415904 AGTGGGTGGATCAGATAGAGGGG - Intronic
1055066035 9:72119407-72119429 AGTGGGAGGATCACTTAGGGAGG + Intronic
1058452955 9:105114102-105114124 AATGGGTGGAGCAAATGGAGAGG + Intergenic
1059514548 9:114880838-114880860 AGTGGGCAGATGAGATAGAGTGG + Intergenic
1059759545 9:117325079-117325101 AGTGGGTTGATAACAGAGAGTGG + Intronic
1062177526 9:135172271-135172293 GGTGGGTGGGTCTGATGGAGAGG - Intergenic
1185955823 X:4487895-4487917 AGTGGGTGCCTCAGCAAGAGAGG + Intergenic
1186518483 X:10185305-10185327 AGTGGGAGGAGCAGATATATTGG + Intronic
1187786510 X:22893806-22893828 AGTGAGTGGAGCAAATAGAGGGG - Intergenic
1188303765 X:28537352-28537374 AATTGGAGGACCAGATAGAGGGG - Intergenic
1188353152 X:29157003-29157025 AGTTGGTGGCTGAGAAAGAGTGG + Intronic
1189193504 X:39132487-39132509 AGTAGGTGGCTCAGCAAGAGTGG + Intergenic
1192259778 X:69498399-69498421 GGTGGGTGGCTGAGGTAGAGTGG + Intergenic
1192340161 X:70257742-70257764 AGTGGATGGCTCAGACTGAGGGG - Intergenic
1195306373 X:103586927-103586949 GGAGGGAGGATCAGAGAGAGAGG + Exonic
1196125629 X:112095769-112095791 AGTGGGTGGCTGAGGTACAGTGG + Intergenic
1196321171 X:114341731-114341753 ATCTGGTGGATTAGATAGAGAGG - Intergenic
1197113948 X:122809469-122809491 AATGGGTGGCTAAGATAGAATGG - Intergenic
1197733215 X:129829394-129829416 AGTGGGTTGATAGGATAGATTGG - Intronic
1198633978 X:138674771-138674793 AGTGGATGGCTGAGATAGGGTGG + Intronic
1199033509 X:143027542-143027564 TGTGGGTGGATCTGATAGACTGG + Intronic
1200396174 X:155989645-155989667 AGGGGATGGAGCAGATGGAGAGG + Intergenic
1201616643 Y:15907915-15907937 AGTGGGTGGGTGGGATAAAGGGG + Intergenic