ID: 1053480962

View in Genome Browser
Species Human (GRCh38)
Location 9:38415883-38415905
Sequence GAGTGGGTGGATCAGATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480962_1053480970 11 Left 1053480962 9:38415883-38415905 CCCTCTATCTGATCCACCCACTC 0: 1
1: 0
2: 2
3: 25
4: 220
Right 1053480970 9:38415917-38415939 CCCATCTGAGGGCCCTCTGAAGG No data
1053480962_1053480972 12 Left 1053480962 9:38415883-38415905 CCCTCTATCTGATCCACCCACTC 0: 1
1: 0
2: 2
3: 25
4: 220
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480962_1053480968 0 Left 1053480962 9:38415883-38415905 CCCTCTATCTGATCCACCCACTC 0: 1
1: 0
2: 2
3: 25
4: 220
Right 1053480968 9:38415906-38415928 ATTCAGCTGTACCCATCTGAGGG No data
1053480962_1053480967 -1 Left 1053480962 9:38415883-38415905 CCCTCTATCTGATCCACCCACTC 0: 1
1: 0
2: 2
3: 25
4: 220
Right 1053480967 9:38415905-38415927 CATTCAGCTGTACCCATCTGAGG No data
1053480962_1053480973 15 Left 1053480962 9:38415883-38415905 CCCTCTATCTGATCCACCCACTC 0: 1
1: 0
2: 2
3: 25
4: 220
Right 1053480973 9:38415921-38415943 TCTGAGGGCCCTCTGAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480962 Original CRISPR GAGTGGGTGGATCAGATAGA GGG (reversed) Intronic
902243362 1:15103028-15103050 GGGTGGGTGGATCACAAACAAGG + Intronic
903009731 1:20321047-20321069 GAGAGGGTAGATCACATAGAAGG + Intronic
904284294 1:29444080-29444102 GAGGGGGTGGACTAGAGAGATGG - Intergenic
906986744 1:50691094-50691116 GAATTGCTGGGTCAGATAGATGG + Intronic
909216283 1:72894328-72894350 GAATGGATGTATCAGAAAGAAGG - Intergenic
915838987 1:159200720-159200742 GAGTGGGTGGGTGAGAAAGTGGG + Intronic
916000877 1:160614155-160614177 AATTGGGTGGTTCAGATAGATGG + Intronic
916256763 1:162796219-162796241 GAGTGGGTTTAAGAGATAGAGGG + Intronic
917685643 1:177412996-177413018 GAGTGGATGCATCAGGTAGGAGG - Intergenic
917835178 1:178936091-178936113 GAGTGTGTGGCTCAGATCGTTGG + Intergenic
918068052 1:181114853-181114875 GTATGGGAGGATCAGATAGCTGG - Intergenic
919190489 1:194210926-194210948 GAATGGCTGGATCACATAGAAGG + Intergenic
921620885 1:217325066-217325088 GAGTGCCTGGAAAAGATAGATGG - Intergenic
921659155 1:217778286-217778308 GAGTGGGTGGATCACCTACGAGG + Intronic
921954062 1:220963669-220963691 GAGAAGGTGGACCACATAGATGG - Intergenic
922648230 1:227312857-227312879 GAGTGGGAGGAAGAGAGAGAAGG - Intronic
923293610 1:232571765-232571787 GAGTGGAAGAATCAGACAGAAGG - Intergenic
924457536 1:244230661-244230683 GAGTGGGTGGATGAGTGGGACGG - Intergenic
1063595972 10:7435968-7435990 GACAGGGTGGACCAGATGGAGGG + Intergenic
1063808211 10:9672286-9672308 GAGTTGGTGGATCCAAGAGAGGG + Intergenic
1064137179 10:12761189-12761211 GAGTGGGTGCAGCAGATGGTGGG + Intronic
1064155899 10:12902920-12902942 GAGTGGGAGGATCATTGAGATGG + Intronic
1064988415 10:21234381-21234403 GAGAGGGTGCATGAGAGAGAAGG - Intergenic
1065563724 10:26988673-26988695 GAGTGGGTACAGCTGATAGAAGG + Intergenic
1065564597 10:26996076-26996098 GAGTGGGTACAGCTGATAGAAGG + Intronic
1069120903 10:64567810-64567832 CAGTGGGTGGAGCCGATGGAGGG - Intergenic
1070340141 10:75490728-75490750 GAGTGGTAGGGTCACATAGATGG - Intronic
1072493954 10:95936073-95936095 GGGTGGGAGGATCAGAGACACGG - Intronic
1073146588 10:101285504-101285526 GAAAGGGTGGACCAGAGAGAGGG + Intergenic
1074112016 10:110429479-110429501 GGCTGGGTGGATTAGAGAGATGG - Intergenic
1074907370 10:117876970-117876992 CAGTGGGTGGAGAAGATAGCTGG - Intergenic
1075557582 10:123444592-123444614 GAGGGGGAGGCTCAGAGAGATGG + Intergenic
1077599763 11:3566142-3566164 GAGTGGGTTGGATAGATAGATGG + Intergenic
1079917082 11:26382444-26382466 GAGTGGGTGGATGAGGGAGGAGG - Intronic
1082737358 11:56871707-56871729 GAGTGAGAGGAACAGAAAGAAGG - Intergenic
1083828376 11:65216040-65216062 GAGTGGGTGGATGAGTGAGTGGG + Intergenic
1085219848 11:74864738-74864760 GAGGGGGTGGATCAGAAAAACGG - Intronic
1085755636 11:79199045-79199067 GTGTGGGTGGAGCAAAGAGAGGG + Intronic
1086943105 11:92818368-92818390 GAGTGTGTGGGACAGAGAGAAGG + Intronic
1088742349 11:112777442-112777464 GTGTGGGAGGAGCAGAGAGACGG - Intergenic
1088919849 11:114252815-114252837 GATTTGGTGGATGAGATTGAAGG - Intergenic
1089165787 11:116475484-116475506 GAGTGGATGGAACAGAGGGAGGG + Intergenic
1089381861 11:118038947-118038969 GAGGGGGTGGAGCAGAGAGTGGG + Intergenic
1089416718 11:118298210-118298232 GACTGGGTGGGTCAGTGAGATGG - Intergenic
1091017123 11:132061938-132061960 GTGTGTGTGGATCAGATAGGGGG + Intronic
1093809344 12:23473007-23473029 GAGTGGGTGCTCCAGATAGCTGG - Intergenic
1097685259 12:62684999-62685021 GAGGGGGTGGAACTGTTAGAAGG - Intronic
1100367720 12:93936858-93936880 GAGTGGGAGGAACAGAAAGGAGG + Intergenic
1102260239 12:111438878-111438900 GTGTGGCTGGATCAGAGCGAGGG + Intronic
1103841902 12:123871920-123871942 GAGTGAGTGCTTAAGATAGATGG + Intronic
1104610596 12:130224743-130224765 TAGTGGGTGGACCAGATGGCAGG + Intergenic
1108460733 13:50665134-50665156 GACTTGGTGGATCTGACAGATGG - Intronic
1110461233 13:75747897-75747919 GAGAGGGAGAACCAGATAGATGG + Intronic
1111384448 13:87505767-87505789 TAGTTGGTGGAGCAGTTAGAAGG + Intergenic
1111943734 13:94641423-94641445 GAGTGGCTGGATCTGAGAGAGGG - Intergenic
1112023336 13:95390951-95390973 CATTGGGTGGCTGAGATAGATGG - Intergenic
1113196186 13:107809516-107809538 CAGTGGGTGCGTCAGTTAGAGGG - Intronic
1113775265 13:112941001-112941023 GAGTGAGTGAATCAGACACATGG + Intronic
1113880111 13:113620157-113620179 CTGTGGGTGGAGCAGATGGAGGG + Intronic
1114241316 14:20871050-20871072 GAGTGGGTCAATCAGAGAGATGG - Intergenic
1116885724 14:50219138-50219160 GAGTGGTTGGATCGGATAGTAGG - Intronic
1120964527 14:90155756-90155778 CTGTGGGTGGATCAGATTGGAGG + Intronic
1121517274 14:94561060-94561082 GAGGGGCTGGATCAGACAGGGGG - Intergenic
1121603760 14:95225646-95225668 GAGTGAGTGGGGCAGAGAGAAGG - Intronic
1124259223 15:28173187-28173209 GAGTGGATGGATCATATGGCAGG - Intronic
1124316950 15:28678185-28678207 GAGTGGTTGGATCATATGGTAGG - Intergenic
1124566501 15:30819314-30819336 GAGTGGTTGGATCATATGGTAGG + Intergenic
1124965566 15:34430468-34430490 GACTGAGTGGGTCAGATTGATGG - Intronic
1126592861 15:50357075-50357097 GAGTTGGTGGAGCAGCTAGGAGG + Intergenic
1126663702 15:51056434-51056456 AAGTGGGTGGATCTGTGAGATGG - Intergenic
1127732938 15:61816968-61816990 GATTGGGTGGGTCAAGTAGACGG + Intergenic
1128691034 15:69725126-69725148 GAGTGGGTAGAGCAGAAAGAGGG + Intergenic
1129464059 15:75713864-75713886 GATGGGCTGGAGCAGATAGATGG - Intergenic
1130913328 15:88285715-88285737 GAGTGGGTGGGTGGGATAAATGG - Intergenic
1131369160 15:91865383-91865405 GAGAGGGTGGATGAGATGGTAGG + Intronic
1131462786 15:92630473-92630495 GAGTGTGAGGATCTGATGGAAGG + Intronic
1131838671 15:96414864-96414886 GAGTGGGTAGATAAAATAGAGGG - Intergenic
1132976871 16:2715464-2715486 GAGTGGGTGGAGGGGATGGAGGG + Intronic
1135174047 16:20212431-20212453 GAGAAGTTGGATCAGAGAGATGG + Intergenic
1138305408 16:55970018-55970040 GAGTGGGTTCATCAGATGGCTGG - Intergenic
1140197375 16:72866221-72866243 GAGAGGGAGGGTCAGAAAGAAGG + Intronic
1142570112 17:868210-868232 GGAAGGGTGGATCGGATAGAGGG - Intronic
1143051850 17:4132600-4132622 AAGTGGGTGGATCACAAAGTCGG + Intronic
1143554177 17:7650693-7650715 GGGTGGGAGGAAGAGATAGAGGG - Intronic
1143635088 17:8159825-8159847 GAGGAGGTGGATCAGGCAGATGG + Exonic
1144266317 17:13573195-13573217 GAGAGGGTGGATGAGATCTAGGG - Intronic
1144937213 17:18909577-18909599 GAATGGCTGGATCATATAGTAGG - Intronic
1145261409 17:21356922-21356944 GGGTGGGTGGGTAAGATGGATGG - Intergenic
1145861169 17:28211688-28211710 GAGTGGGTGCAGCACATGGAAGG + Intergenic
1151345821 17:73500601-73500623 GAGAGGATGGAGGAGATAGAAGG - Intronic
1151527512 17:74681092-74681114 GGCTGGGTGGATCAGAGGGATGG + Intronic
1152232369 17:79120425-79120447 GAGTGGATGGATCAGAAGGTGGG + Intronic
1153478053 18:5518244-5518266 GTGTGGTTGGAGCAGAGAGAGGG - Intronic
1153944602 18:10008151-10008173 ATGTGGGTGGATGAGGTAGATGG - Intergenic
1153970220 18:10219616-10219638 GACTGGGTGGATCAGATCATAGG - Intergenic
1154465785 18:14641958-14641980 GAGTGGGGGGAAGAGAGAGAAGG - Intergenic
1156463058 18:37332484-37332506 GAGTGGGGAGAGCAGAGAGAAGG - Intronic
1157365169 18:47058078-47058100 TGGTGGGTGGATCACATAGGTGG + Intronic
1159544892 18:69827134-69827156 GAGTGATTGGATCAGATTTATGG - Intronic
1159904339 18:74076642-74076664 GAGTGGGGAGATCAGTTAGATGG - Intronic
1160479701 18:79227429-79227451 GAGTGGGTGAATCGGATGGATGG + Intronic
1160734770 19:657511-657533 GAGTGGGTGCTGCAGAGAGAGGG - Intronic
1161421773 19:4179840-4179862 GAGAGGGAAGATCAGACAGAAGG + Intronic
1161489380 19:4553553-4553575 GAGTGGGTGAATGAGATGGATGG + Intronic
1161555046 19:4936456-4936478 GATTGGGAGGCTCAGATAGGTGG + Intronic
1161854491 19:6755396-6755418 GAGTGGATGGATCAGGTGGGTGG - Intronic
1162031840 19:7920855-7920877 GAGTGGGTGGGTGAGTTTGAGGG + Intronic
1162391148 19:10390923-10390945 GAGTGGGTGGGTGAGACTGAAGG + Intergenic
1163186593 19:15643258-15643280 GAATGGATGGATTAGATAGATGG + Intronic
1164189178 19:22899607-22899629 GAATGAGTGGGTCAGAGAGAAGG + Intergenic
1164507841 19:28874166-28874188 GAGGGGGTGGAAGAGATGGAGGG + Intergenic
1164650856 19:29890423-29890445 GGGTGGGTGGATGGGATAGATGG - Intergenic
1164650962 19:29890929-29890951 GGGTGGGTGGGTGGGATAGATGG - Intergenic
1166772874 19:45294847-45294869 GACTGGCTGGAGCAGAGAGAGGG + Intronic
1166958420 19:46482115-46482137 GAGTGGGTGGCCCTGAAAGATGG - Intronic
1167461370 19:49626177-49626199 GAGTGGGAGGGGCAGAGAGAGGG - Exonic
1167468572 19:49663101-49663123 GAGTGGGGGGATCGTCTAGAGGG + Intronic
925606552 2:5666381-5666403 GAGTGGGTGGAGCACGTGGAGGG - Intergenic
926592163 2:14751416-14751438 GAGTATGTGAATCAGAGAGAAGG + Intergenic
927179190 2:20432308-20432330 GAGTGGGTGGTTCATTGAGAAGG + Intergenic
929851396 2:45593863-45593885 GAGTGGTTGTATGAGACAGAAGG + Intronic
929862934 2:45694681-45694703 TGGTGGGTGGATTGGATAGATGG + Intronic
930634764 2:53792145-53792167 AAACGGGCGGATCAGATAGAGGG - Intronic
930871980 2:56180110-56180132 GAGTGTGTGGCTCAGACTGAAGG + Intergenic
933122916 2:78564835-78564857 GAGTGGTTGCAACAGATAGTAGG + Intergenic
933616305 2:84485548-84485570 TAGTGGGTGGAACCTATAGAGGG + Intergenic
936073580 2:109387431-109387453 GAGTGGCTGGAGCAGACACATGG - Intronic
937630898 2:124099896-124099918 AAGTGATTGGATCAGATGGATGG - Intronic
938161451 2:128988116-128988138 GTGTAGGTGGAACAGAGAGAGGG + Intergenic
945198258 2:207257298-207257320 CAGTGGGTGCAGCAGGTAGAAGG + Intergenic
945372209 2:209033029-209033051 GAATGGGAGGACCAGATAAAGGG - Intergenic
946268291 2:218568102-218568124 GAGTGGGCGGATCGCACAGAAGG + Intronic
948707540 2:239804436-239804458 GAGTGAGTGGATGAGCTACAGGG - Intergenic
1169682223 20:8228301-8228323 GAGTGGGTGTATGAGATAGTGGG - Intronic
1170587168 20:17743463-17743485 GAGTGTGTGGGTTAGTTAGATGG - Intergenic
1174306809 20:49619236-49619258 GGATGGGTGGATGAGATGGATGG + Intergenic
1175137941 20:56839197-56839219 GAGTGGGTGGGTGAGATGGATGG + Intergenic
1176808805 21:13516636-13516658 GAGTGGGGGGAAGAGAGAGAAGG + Intergenic
1178474014 21:32920568-32920590 GAGTGGGTGGAGCAGACGCAGGG + Intergenic
1178716734 21:34971552-34971574 GGGTGGGTGGATAAGATAGATGG - Intronic
1179622810 21:42629445-42629467 AAGTAGATGGATGAGATAGATGG + Intergenic
1183358526 22:37371804-37371826 GGGTGGGGGGGTCAGAAAGAGGG + Exonic
1183950071 22:41347829-41347851 GAGTGGTGGGATCAGAGGGAGGG + Intronic
1184281701 22:43441069-43441091 CAGTGGCTGGATGAGAGAGATGG - Intronic
1184627140 22:45744068-45744090 GAATGGGTGAATCAGAAACAAGG - Intronic
950333164 3:12173362-12173384 AAGTGGGTGGATGTGATAGCAGG - Intronic
952585985 3:34892856-34892878 GGGTGGGAAGATGAGATAGAGGG + Intergenic
953023319 3:39129845-39129867 GAGTGAGAGGAACAGGTAGAGGG + Intronic
953779386 3:45853087-45853109 GGGTAGGTGGAACAGATGGAAGG + Intronic
953782987 3:45887819-45887841 GAGTGGATGGATCTGATAGATGG + Intronic
955541088 3:59977000-59977022 GGGTGGGTGGATCAGGCAGTGGG + Intronic
957070577 3:75564778-75564800 GAGTGGGTTGGATAGATAGATGG + Intergenic
959404830 3:105948395-105948417 GAATGGCTGGATCATATAGTAGG + Intergenic
960805032 3:121575509-121575531 GAGTGGGTGAGACAGAGAGAGGG + Intronic
962450476 3:135511990-135512012 GAATGGCTGGATCATATAGTAGG - Intergenic
965313697 3:167163856-167163878 CAGAGGTTGGATCAGAAAGAAGG - Intergenic
965674249 3:171178205-171178227 GAATGGCTGGATCAGATAGTAGG + Intronic
968895344 4:3397610-3397632 GGGTGGGAGGAGCAGATAGGGGG + Intronic
969475976 4:7422624-7422646 GAGTGTGTGGGTCTGAGAGATGG - Intronic
969739788 4:9015973-9015995 GAGTGGGTTGGATAGATAGATGG - Intergenic
970558410 4:17258948-17258970 GAGAGGATGGATCAGGGAGAAGG + Intergenic
972589934 4:40475883-40475905 GAGTGGGTGGTACAGAAAGAAGG + Intronic
972828768 4:42789958-42789980 GAGTAGGAGGATGAGAGAGAAGG + Intergenic
973260790 4:48161263-48161285 GAGTGGGTGGCATAGTTAGAAGG - Intronic
973607869 4:52605803-52605825 GTGTGGCTGGAGCAGAGAGAAGG - Intronic
974911116 4:68121092-68121114 AACTGGGTGGGTCATATAGAAGG - Intronic
975069494 4:70116285-70116307 TAGTGGGTGGAACAGAGTGATGG + Intergenic
978737492 4:112100423-112100445 GAGTGGGTGGAACAGGGAGTGGG + Intergenic
979267464 4:118720071-118720093 GAGCGGGTGGATCACAGAAAGGG - Intergenic
980236661 4:130116248-130116270 GAGTTGGAAGATCAGATAAATGG - Intergenic
981130522 4:141153666-141153688 GAGTGGGTAGATGATATAGTAGG + Intronic
981655880 4:147112082-147112104 CAGTGGGTGCATCCCATAGAGGG + Intergenic
981788068 4:148503183-148503205 GAGTGGGTGCAGCACACAGAGGG - Intergenic
986308754 5:6535715-6535737 GAGTGGTTGGATCTGATACAGGG + Intergenic
987211307 5:15686460-15686482 GATGGGGTGATTCAGATAGAGGG - Intronic
988162207 5:27533264-27533286 GTGTGTGTGGCTCTGATAGATGG - Intergenic
989109897 5:37897073-37897095 GAGTGGGGGGATCAGAAGCAGGG - Intergenic
989729285 5:44629038-44629060 CAGTGGGTGGAGCAGTAAGAAGG - Intergenic
994285562 5:97961105-97961127 GAATGTGAGGATCAAATAGATGG - Intergenic
995688065 5:114792985-114793007 GAGTGGATACATCAGTTAGATGG + Intergenic
996383178 5:122882981-122883003 GAATGGGTGGAGCAGATCAAGGG + Intronic
999756089 5:154665534-154665556 GAGTGGGAGCATGAGAGAGAAGG + Intergenic
999826805 5:155281383-155281405 GAGTGGGTGGCTCAGAGGGCTGG + Intergenic
1000359752 5:160436044-160436066 GACTGGGTGGTTGAGGTAGATGG + Intergenic
1000403719 5:160863162-160863184 GAGTGGGAGCATCAGATATTGGG - Intergenic
1001036485 5:168300366-168300388 GAGGGGGTGGAGCAGAGAGTGGG + Intronic
1002690974 5:181050348-181050370 GAGTTGGTGGTCCAGATAGCAGG + Exonic
1004109860 6:12706733-12706755 GAGTGGCTGGATCATATGGTAGG + Intergenic
1005266264 6:24115345-24115367 GTGTGGCTGGAACATATAGAAGG + Intergenic
1005926292 6:30448360-30448382 TGATGGGTTGATCAGATAGATGG - Intergenic
1007438385 6:41835204-41835226 GGATGGGTGGATGAGATGGAAGG + Intronic
1009895830 6:69747224-69747246 GAGAGGGTGGAGGAGAGAGAAGG - Intronic
1011678596 6:89760350-89760372 GAGTGTGTGGATGTGAGAGAGGG - Intronic
1013374212 6:109498347-109498369 GAGGGGGTGGGCCAGATACATGG + Intronic
1015037174 6:128669703-128669725 GTGTGGTTGGATCAAGTAGAGGG + Intergenic
1016755390 6:147679179-147679201 GAGTGGCTGGATCGAATAGTGGG + Intronic
1018125229 6:160676291-160676313 GAGTGGGTGGACCACATTCATGG + Intergenic
1019055062 6:169218027-169218049 GGGTGGGTGGATGAGATGGATGG + Intronic
1019055091 6:169218123-169218145 GGGTGGGTGGATGAGATGGATGG + Intronic
1019055113 6:169218230-169218252 GGGTGGCTGGATGAGATGGATGG + Intronic
1019055160 6:169218439-169218461 GGGTGGGTGGCTGAGATGGATGG + Intronic
1019055233 6:169218734-169218756 AGGTGGGTGGATGAGATGGATGG + Intronic
1019055255 6:169218816-169218838 GGGTGGGTGGCTGAGATGGATGG + Intronic
1019055299 6:169219039-169219061 AGGTGGGTGGATGAGATGGATGG + Intronic
1019055381 6:169219399-169219421 GGGTGGATGGATGAGATATATGG + Intronic
1019161459 6:170069688-170069710 GAATGGCTGGATCATATAGTAGG + Intergenic
1019555837 7:1630909-1630931 GGGTGGGTGGATGGGATAAATGG - Intergenic
1021623033 7:22566300-22566322 GCGTGGCTGGAGCAGTTAGAAGG - Intronic
1022602827 7:31777886-31777908 GAGTTGGTGGAGAACATAGAGGG + Intronic
1028870784 7:95770002-95770024 GTTTGGGTGGATGAGATGGAAGG - Intergenic
1029654098 7:101913194-101913216 GATTGGGTTGATCAGATTTAAGG - Intronic
1030969315 7:116034645-116034667 GTGTGTGTGTAACAGATAGAAGG - Intronic
1030978790 7:116161835-116161857 GAAAGGGTGAATCTGATAGATGG + Intergenic
1031804716 7:126293494-126293516 TAGATGGAGGATCAGATAGACGG + Intergenic
1038982075 8:32770876-32770898 GAGGGGAAGGATCAAATAGAAGG - Intergenic
1039412497 8:37366603-37366625 GAGTGGGAGGATCAGATCATTGG - Intergenic
1040040653 8:42913647-42913669 GAGTGGCTGGATCATATGGTAGG + Intronic
1040079819 8:43275048-43275070 GAGTGGGAGGAGGAGAGAGAGGG - Intergenic
1040139753 8:43896330-43896352 GAGAAGTGGGATCAGATAGATGG - Intergenic
1041545781 8:59040822-59040844 GAGTGGGAGGGTCAGAGAGGCGG - Intronic
1044994982 8:97830198-97830220 GAGTGGGTGGGTGAGGTTGATGG + Intronic
1045500788 8:102742952-102742974 GAGTGGGAGGAGCAGCAAGAAGG + Intergenic
1046005558 8:108478361-108478383 GAGAGGGTGGATCAAATTGCAGG + Intronic
1047485081 8:125322345-125322367 GAGTGAGTGAAGCAGAAAGAAGG + Intronic
1047692435 8:127370098-127370120 AAGTGGGTGGATGAGTAAGAAGG + Intergenic
1048028238 8:130606487-130606509 TAGTGGGTGGATAACAGAGATGG - Intergenic
1048396754 8:134021253-134021275 AAGTGGGTTGATGAGATAGAGGG - Intergenic
1048851606 8:138650569-138650591 GAGAGGGAGGATTAGAGAGAAGG - Intronic
1049287147 8:141782008-141782030 CAGTGGGTGGAGCAGGTGGACGG + Intergenic
1051551093 9:18330329-18330351 GAGTGGCAGGATCAGGGAGAAGG - Intergenic
1053480962 9:38415883-38415905 GAGTGGGTGGATCAGATAGAGGG - Intronic
1056499576 9:87195156-87195178 GAGTGGAGGGAGAAGATAGATGG + Intergenic
1058089822 9:100792630-100792652 TAGTGGCTGGATCATATAGTAGG + Intergenic
1058739064 9:107924310-107924332 GAGAAGGTAGCTCAGATAGAAGG - Intergenic
1059442816 9:114319383-114319405 GAGTGGGTGTATCAGGGAGCTGG - Intergenic
1060972550 9:127747112-127747134 GAGGGGGTGGAGCAGGTGGAGGG - Intronic
1061287248 9:129631096-129631118 GAGGGGGTGGGGCAGACAGAGGG - Intronic
1062018465 9:134304314-134304336 GGCTGGGTGGATCAGAGATAGGG - Intergenic
1185613496 X:1406193-1406215 GAATGGATGGATGAGATGGATGG + Intronic
1186114951 X:6295594-6295616 GAGTAGGAGGATGAGAAAGAAGG - Intergenic
1187786511 X:22893807-22893829 TAGTGAGTGGAGCAAATAGAGGG - Intergenic
1188006962 X:25022277-25022299 GAGCGGGAGGAGCAGATGGAAGG + Intergenic
1190118281 X:47639675-47639697 GAGTGGGAAAATCAGATAGACGG - Intronic
1193333108 X:80257088-80257110 GAGTAGGAGGAACAGAGAGAAGG - Intergenic
1196830612 X:119772789-119772811 GAGTGGCTGGAGCAGAGTGAGGG - Intergenic
1197179200 X:123516213-123516235 GACTGGGTGGATTAGAGAGATGG - Intergenic
1198703936 X:139426850-139426872 GAGTGGATGGAACAAATAAAGGG - Intergenic
1199583220 X:149381820-149381842 GAGGGGGATGATCTGATAGAAGG + Intergenic