ID: 1053480963

View in Genome Browser
Species Human (GRCh38)
Location 9:38415884-38415906
Sequence TGAGTGGGTGGATCAGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480963_1053480967 -2 Left 1053480963 9:38415884-38415906 CCTCTATCTGATCCACCCACTCA 0: 1
1: 0
2: 2
3: 20
4: 203
Right 1053480967 9:38415905-38415927 CATTCAGCTGTACCCATCTGAGG No data
1053480963_1053480973 14 Left 1053480963 9:38415884-38415906 CCTCTATCTGATCCACCCACTCA 0: 1
1: 0
2: 2
3: 20
4: 203
Right 1053480973 9:38415921-38415943 TCTGAGGGCCCTCTGAAGGGTGG No data
1053480963_1053480972 11 Left 1053480963 9:38415884-38415906 CCTCTATCTGATCCACCCACTCA 0: 1
1: 0
2: 2
3: 20
4: 203
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480963_1053480970 10 Left 1053480963 9:38415884-38415906 CCTCTATCTGATCCACCCACTCA 0: 1
1: 0
2: 2
3: 20
4: 203
Right 1053480970 9:38415917-38415939 CCCATCTGAGGGCCCTCTGAAGG No data
1053480963_1053480968 -1 Left 1053480963 9:38415884-38415906 CCTCTATCTGATCCACCCACTCA 0: 1
1: 0
2: 2
3: 20
4: 203
Right 1053480968 9:38415906-38415928 ATTCAGCTGTACCCATCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480963 Original CRISPR TGAGTGGGTGGATCAGATAG AGG (reversed) Intronic
900194426 1:1368393-1368415 TGGGTGTGTTCATCAGATAGCGG + Intergenic
900652897 1:3739335-3739357 TGATTGTGTGGGTTAGATAGAGG - Intergenic
900652902 1:3739371-3739393 TGATTGTGTGGGTTAGATAGAGG - Intergenic
900652907 1:3739407-3739429 TGATTGTGTGGGTTAGATAGAGG - Intergenic
900652912 1:3739443-3739465 TGATTGTGTGGGTTAGATAGAGG - Intergenic
900652966 1:3739835-3739857 TGATTGTGTGGGTTAGATAGAGG - Intergenic
900848200 1:5120700-5120722 TGAGTGGGTGGGTGTGAAAGTGG - Intergenic
904042833 1:27594129-27594151 TTAGGGGGTGGAACAGATGGTGG + Intronic
905997083 1:42390579-42390601 TGGGTGGGTAGATGTGATAGTGG + Intronic
907272030 1:53296804-53296826 TGAGAGGGTGGCTCTGGTAGTGG - Intronic
915838986 1:159200719-159200741 TGAGTGGGTGGGTGAGAAAGTGG + Intronic
917619401 1:176780579-176780601 TGAGTGGGTTCACCAGGTAGAGG - Intronic
917683948 1:177396735-177396757 AGAGTGGGTGGAACAGGTTGTGG + Intergenic
917702772 1:177597809-177597831 TGAGTGGGTGTGTCACAAAGGGG - Intergenic
920731014 1:208484484-208484506 TGAGTGGGATGATCAGATGATGG - Intergenic
920833367 1:209485316-209485338 GGAGTGGGTGGAACAGCAAGAGG + Intergenic
1064137178 10:12761188-12761210 AGAGTGGGTGCAGCAGATGGTGG + Intronic
1067929099 10:50541684-50541706 AGAGTGGGTGGCTCAGCCAGGGG - Intronic
1072610629 10:97015069-97015091 GGGGTGTGTGGATCAGAGAGAGG + Intronic
1075409275 10:122215428-122215450 TGGGAAGGTGGATCAGAGAGAGG - Exonic
1076730793 10:132437862-132437884 GGTGTGGGTGGATCAGATGTAGG - Intergenic
1076845078 10:133065905-133065927 TGAGTGGGTGGATGAGTGGGTGG + Intergenic
1076845093 10:133065957-133065979 TGAGTGGGTGGATGAGTGGGTGG + Intergenic
1076845108 10:133066009-133066031 TGAGTGGGTGGATGAGTGGGTGG + Intergenic
1077172427 11:1173461-1173483 TGAGTGAGTGGATGAGTGAGTGG - Intronic
1077172437 11:1173585-1173607 TGAGTGAGTGGATGAGTGAGTGG - Intronic
1077172448 11:1173752-1173774 TGAGTGAGTGGATGAGTGAGTGG - Intronic
1077218100 11:1403470-1403492 TGAGTGGAAGGAGCAGAGAGGGG - Intronic
1077418116 11:2435358-2435380 TGAGTGGGTGGGTGAGTGAGTGG - Intergenic
1077762610 11:5119421-5119443 TGGGTGGGTGGGTCAAATGGTGG + Intergenic
1079390849 11:20020891-20020913 TGAGTGGCTGGAGCAGTGAGCGG - Intronic
1080872860 11:36252151-36252173 TGGGTGGGTGGGTCACATGGTGG + Intergenic
1081730793 11:45370428-45370450 TGGGTGGGTGGATGAAAGAGTGG - Intergenic
1083364404 11:62132804-62132826 TGAGGGGGTGGAGGAGAGAGAGG + Intronic
1083828368 11:65215999-65216021 TGAGTGGGCGGATGAGTGAGTGG + Intergenic
1083828375 11:65216039-65216061 TGAGTGGGTGGATGAGTGAGTGG + Intergenic
1083828381 11:65216067-65216089 TGAGTGGGTGGGTGAGTGAGTGG + Intergenic
1083828390 11:65216099-65216121 TGAGTGGGCGGATGAGTGAGTGG + Intergenic
1083828393 11:65216127-65216149 TGAGTGAGTGGATGAGTGAGTGG + Intergenic
1083828404 11:65216198-65216220 TGAGTGGGTGGGTGAGTGAGTGG + Intergenic
1083828492 11:65216686-65216708 TGAGTGAGTGGATGAGTGAGTGG + Intergenic
1083828519 11:65216778-65216800 TGAGTGGGTGGGTGAGTGAGTGG + Intergenic
1083828533 11:65216826-65216848 TGAGTGGGTGGGTGAGTGAGTGG + Intergenic
1083828552 11:65216894-65216916 TGAGTGGGTGGGTGAGTGAGTGG + Intergenic
1084413323 11:69016376-69016398 TGAGTGGGTAGATGAGTAAGTGG - Intergenic
1087058456 11:93955960-93955982 TGAGTGCATGGGTCAAATAGTGG + Intergenic
1087447449 11:98272803-98272825 TGAATGGGCTGATCAGATATAGG + Intergenic
1089381860 11:118038946-118038968 AGAGGGGGTGGAGCAGAGAGTGG + Intergenic
1089580086 11:119476260-119476282 TGAGTGGGTGGATGAGTGGGTGG + Intergenic
1090857082 11:130619634-130619656 TGGGTGGGTGAATGAGTTAGTGG - Intergenic
1091017122 11:132061937-132061959 TGTGTGTGTGGATCAGATAGGGG + Intronic
1091214409 11:133891837-133891859 GGAGTGGGTTGATGAGAAAGTGG - Intergenic
1096486125 12:51982547-51982569 TGAGTGGCTGGTTCACATTGTGG + Intronic
1096743825 12:53712884-53712906 TGAGTGCATTGATAAGATAGGGG + Intronic
1099478787 12:83140851-83140873 GGAGTGGGGGGGTCAGATAAGGG + Intergenic
1100300088 12:93298937-93298959 TGAGTGGCTGGCTAAGCTAGTGG + Intergenic
1103156962 12:118693804-118693826 TCACTGGTTGGATCAGCTAGCGG - Intergenic
1104386266 12:128354262-128354284 TGAGTGGCCGGATCAGAGAGGGG - Intronic
1104526581 12:129529697-129529719 TGAGTGGATGGATGAGAGGGTGG - Intronic
1111943735 13:94641424-94641446 GGAGTGGCTGGATCTGAGAGAGG - Intergenic
1113912670 13:113851288-113851310 TGAGTGGGTGGATGAGTGAGTGG + Intronic
1114638958 14:24206303-24206325 TGAGTGGGTGGATGGGAAAGAGG - Intronic
1116529968 14:45958056-45958078 TGAATGGGTGGATCATATGCGGG + Intergenic
1117928149 14:60806831-60806853 TGAGTGGTTGGTAAAGATAGTGG + Intronic
1120500938 14:85296646-85296668 TGAGTGTGTTGAGGAGATAGTGG - Intergenic
1121254988 14:92524744-92524766 TGAATTGGTGGCTCAGAGAGGGG + Intronic
1121517275 14:94561061-94561083 TGAGGGGCTGGATCAGACAGGGG - Intergenic
1122838765 14:104444263-104444285 TGAGTGGGTGAATGAGTGAGTGG - Intergenic
1122838773 14:104444311-104444333 TGAGTGGGTGAATGAGTGAGTGG - Intergenic
1122923710 14:104890431-104890453 TGAGTGGGTGGATGGGTGAGTGG + Intronic
1123632988 15:22274990-22275012 TGGGTGGGTGGATAGGATGGGGG - Intergenic
1128691033 15:69725125-69725147 AGAGTGGGTAGAGCAGAAAGAGG + Intergenic
1128997176 15:72305871-72305893 TGACTGGGAGGATCAGGTTGGGG - Intronic
1131838672 15:96414865-96414887 AGAGTGGGTAGATAAAATAGAGG - Intergenic
1132976870 16:2715463-2715485 TGAGTGGGTGGAGGGGATGGAGG + Intronic
1133615286 16:7470534-7470556 TGAGTGGGTGGATGGGTGAGTGG + Intronic
1134357986 16:13502087-13502109 TGAATGGGTGGATGAAATAAAGG + Intergenic
1134637071 16:15800524-15800546 TGAGTGAGTGGATGAGAGAGTGG + Intronic
1136111440 16:28065956-28065978 TCAGTGGGTGGCTCAGTGAGTGG - Intergenic
1138225302 16:55289750-55289772 TCAGTGGGTGACTCAGACAGAGG + Intergenic
1138547690 16:57729447-57729469 TGGGTGGGTGGATGAGTGAGTGG + Intronic
1139754335 16:69131489-69131511 GGAGTGGGTGGAGAAGATGGGGG - Intronic
1139975478 16:70806671-70806693 TGAGTGTGGGGAGCAGGTAGAGG + Intergenic
1141445444 16:84055043-84055065 TGAGTGGGAGGAGGAGAAAGGGG + Intronic
1143975038 17:10823376-10823398 TCCGTGGGTGGGTCAGGTAGGGG + Exonic
1144719766 17:17460789-17460811 TGAGTTTGAGGATCAGGTAGAGG - Intergenic
1144970523 17:19106374-19106396 TGAGTGGGTGGCTGAGGCAGGGG + Intergenic
1144990826 17:19232536-19232558 TGAGTGGGTGGCTGAGGCAGGGG + Intronic
1145240099 17:21236041-21236063 TGTGTGGGTGGATGAGTGAGTGG - Intergenic
1145240205 17:21236484-21236506 TGAGTGGGTGGGTGAATTAGTGG - Intergenic
1145240432 17:21237875-21237897 TGAGTGGGTGGATGGGTAAGTGG - Intergenic
1148062428 17:44846109-44846131 TAAGTGGCTGGATCAGAGACAGG - Intergenic
1149178689 17:53906640-53906662 TGAGAGGCTGGCTCAGAAAGAGG + Intergenic
1149265788 17:54926061-54926083 TGGGTTGGTGGAACAGAAAGGGG - Intronic
1150334695 17:64321966-64321988 TGAGTGGTGGGCTCAGATTGAGG - Exonic
1152232368 17:79120424-79120446 TGAGTGGATGGATCAGAAGGTGG + Intronic
1153377066 18:4392581-4392603 TGAGTAGGTGGATCAGCCAAGGG - Intronic
1155401276 18:25442137-25442159 TGTGTGGGTGGTGGAGATAGAGG - Intergenic
1155906279 18:31455633-31455655 TAAGTGGGTGGAGTAGAAAGAGG + Intronic
1160741208 19:686895-686917 TAAGTGGGTGGAGCAGGGAGGGG + Intronic
1161049884 19:2157609-2157631 TGGGTGGGTGGATGGGTTAGTGG - Intronic
1161287740 19:3477548-3477570 TGAGTGGGTGGATGGGTGAGTGG + Intronic
1161287752 19:3477591-3477613 TGAGTGGGTGGATGGGTGAGTGG + Intronic
1161287756 19:3477607-3477629 TGAGTGGGTGGATAGGTGAGTGG + Intronic
1161287765 19:3477639-3477661 TGAGTGGGTGGATGGGTGAGTGG + Intronic
1161287796 19:3477746-3477768 TGAGTGGGTGGATGGGTGAGTGG + Intronic
1161297897 19:3528848-3528870 TGGGTGAGTGGATGAGAGAGTGG + Intronic
1161974391 19:7600319-7600341 TGGGTGGGTGGATGAGTTGGTGG - Intronic
1162091733 19:8284785-8284807 TGAGTGGGGGGAACACATAAGGG - Intronic
1162093970 19:8299632-8299654 TGAGTGGGGGGAACACATAAGGG - Intronic
1163999150 19:21081401-21081423 TCCGGGGGTGGAACAGATAGTGG - Intergenic
1164005077 19:21141227-21141249 TCTGAGGGTGGAACAGATAGTGG - Intergenic
1164030035 19:21395568-21395590 TCCGAGGGTGGAACAGATAGTGG - Intergenic
1164701164 19:30285633-30285655 GGAGTGGATGGGTCAGAGAGGGG - Intronic
929307581 2:40381267-40381289 TGGGTGGGTGGAGCATGTAGTGG - Intronic
930236561 2:48894471-48894493 TGAGTGGGTGGATGGGTGAGTGG - Intergenic
934076934 2:88436589-88436611 TGAATGGGTGGGTGAGGTAGGGG - Intergenic
935893269 2:107704054-107704076 GTAGTGGGATGATCAGATAGAGG + Intergenic
937387934 2:121454020-121454042 TGAGTGTGTGGTTCAGAAATTGG + Intronic
938143331 2:128813450-128813472 TGAGTGGCTGGAGCAGAGAGAGG - Intergenic
938161450 2:128988115-128988137 TGTGTAGGTGGAACAGAGAGAGG + Intergenic
941232630 2:162930501-162930523 TGGGTGGTTGGACCACATAGAGG - Intergenic
941287114 2:163628445-163628467 TGCATGGGGGGACCAGATAGAGG + Intronic
943748812 2:191490118-191490140 TGAGTGGGGGTATGAGTTAGAGG - Intergenic
944609534 2:201387782-201387804 TGACTGGGTGGTGCAGAGAGAGG + Exonic
945372210 2:209033030-209033052 TGAATGGGAGGACCAGATAAAGG - Intergenic
945996567 2:216442039-216442061 TGATTGGCTGGATGAGATAGTGG + Intronic
948251415 2:236533027-236533049 TGAGTGGATGGATGAGTAAGTGG + Intergenic
1169682224 20:8228302-8228324 TGAGTGGGTGTATGAGATAGTGG - Intronic
1171787309 20:29479634-29479656 TTAGGGAGTGGATCAGAAAGTGG - Intergenic
1174916298 20:54657683-54657705 TGAGGGTGGGGATCATATAGAGG - Intergenic
1178474013 21:32920567-32920589 TGAGTGGGTGGAGCAGACGCAGG + Intergenic
1178722627 21:35023458-35023480 TGGGTGGGTGGATCAGACTGAGG + Intronic
1182072050 22:27470544-27470566 TGGATGGGTGGATGAGATGGTGG + Intergenic
1182913198 22:34004822-34004844 GGAGTGTGTGGCTCAGAGAGAGG - Intergenic
1183358525 22:37371803-37371825 TGGGTGGGGGGGTCAGAAAGAGG + Exonic
1183735056 22:39640452-39640474 GAAGTGGGTGGAGCAGATGGAGG + Intronic
1184171864 22:42764803-42764825 TGGGTGGGAGCATCAGAGAGTGG - Intergenic
1185063734 22:48620627-48620649 TGGGTGGGTGGATAGGATGGGGG - Intronic
950025784 3:9819115-9819137 TGAATCGGTAGATCAGAGAGTGG - Intronic
950120741 3:10480961-10480983 GGTGCGGGTGGAGCAGATAGTGG - Intronic
951931224 3:27969177-27969199 TGTGTGGTTGGAGCAGAGAGGGG - Intergenic
952585984 3:34892855-34892877 TGGGTGGGAAGATGAGATAGAGG + Intergenic
952906715 3:38143855-38143877 GGAGTGTGAGGGTCAGATAGGGG - Intergenic
953087275 3:39681877-39681899 TCAGTGGGTGGTTCTGATTGTGG + Intergenic
955136347 3:56222577-56222599 TGAGTAGATGGTTCAGAAAGGGG - Intronic
955144710 3:56305500-56305522 TGTGTGTGTGGATAAGAGAGTGG - Intronic
955541087 3:59976999-59977021 TGGGTGGGTGGATCAGGCAGTGG + Intronic
956141604 3:66151974-66151996 TGAATGGATGGATGAAATAGAGG + Intronic
957935599 3:86937565-86937587 TGAGTGGGTGGAGAAAAGAGCGG + Intergenic
961543931 3:127618991-127619013 TGAGAGGGTGGGTCTGATTGTGG - Intronic
966970437 3:185040542-185040564 TGATAGGGTGGAGTAGATAGAGG - Intronic
967093944 3:186161447-186161469 TGAGTGGATGGATAATAAAGTGG + Intronic
967631862 3:191753234-191753256 TGATGGGGTGGATGAGATACAGG - Intergenic
967907196 3:194511288-194511310 TGGCTGCTTGGATCAGATAGTGG - Intergenic
968895343 4:3397609-3397631 AGGGTGGGAGGAGCAGATAGGGG + Intronic
969618362 4:8266646-8266668 TGAGTGGGTGACTCAGAGGGTGG - Intergenic
973885832 4:55320216-55320238 TGTGTGTGTGTATGAGATAGAGG - Intergenic
977227693 4:94412866-94412888 TGAGTGGGTGGATTAGTCAGCGG - Intergenic
978737491 4:112100422-112100444 GGAGTGGGTGGAACAGGGAGTGG + Intergenic
979917281 4:126452259-126452281 TGGGTGGTTGGAGCAGATAGTGG - Intergenic
982702948 4:158676180-158676202 TGAGTAGGGGGGTCAGAAAGTGG + Intronic
983354991 4:166645552-166645574 AGAGTGAGTGGACTAGATAGAGG - Intergenic
983994425 4:174164079-174164101 TGAGTTGTTGGATCAGAAACTGG - Intergenic
985837205 5:2280291-2280313 TGAGTGGGTGGGTGAGTGAGTGG + Intergenic
985837494 5:2281454-2281476 TGGGTGGGTGGATAAGTGAGTGG + Intergenic
986308753 5:6535714-6535736 TGAGTGGTTGGATCTGATACAGG + Intergenic
987690897 5:21265486-21265508 AGAGTGGGTGAATGTGATAGGGG - Intergenic
990273423 5:54170621-54170643 TGAGGGGGTGGAAAAGAAAGAGG - Intronic
996244168 5:121239622-121239644 TGAGAGAGTGGATCAGATACAGG - Intergenic
999205326 5:149843610-149843632 GGAATGGCTGGATCAGATGGGGG - Intronic
999698705 5:154208360-154208382 TGAGTGGGAGGGGCAGGTAGAGG - Intronic
999835513 5:155366381-155366403 TTAGTGTGTCTATCAGATAGTGG - Intergenic
1000403720 5:160863163-160863185 CGAGTGGGAGCATCAGATATTGG - Intergenic
1000538388 5:162507966-162507988 TGAGGGGTTGTAGCAGATAGAGG - Intergenic
1001036484 5:168300365-168300387 AGAGGGGGTGGAGCAGAGAGTGG + Intronic
1001259927 5:170219672-170219694 TGAGTTGGTGGCTCAGTTGGTGG - Intergenic
1001799562 5:174531077-174531099 TGAGTGTCTGGATTAGATACAGG + Intergenic
1004086336 6:12453122-12453144 TGAGTGTTTTGATGAGATAGTGG + Intergenic
1005204536 6:23386612-23386634 TGAGTAGGTGGAGGAGAAAGAGG - Intergenic
1008595005 6:53033301-53033323 TGAGAGGGTGGCTCAGAAAATGG + Intronic
1008739743 6:54591624-54591646 TGACTTTGTGGATCAGATAGTGG - Intergenic
1013541098 6:111110240-111110262 TGAATGGGAGGAAGAGATAGGGG + Intronic
1015037173 6:128669702-128669724 TGTGTGGTTGGATCAAGTAGAGG + Intergenic
1016755389 6:147679178-147679200 GGAGTGGCTGGATCGAATAGTGG + Intronic
1019707574 7:2503829-2503851 GGAGTGGGAGGATCAGCTGGGGG - Intergenic
1019784935 7:2970070-2970092 TGAGTGAGTGGATGAGTGAGTGG - Intronic
1021754475 7:23838001-23838023 TCAGTGGGTGGATTTGAGAGAGG + Intergenic
1027544517 7:79510150-79510172 AGAGTGAGTGGATCTGATAAAGG - Intergenic
1028242393 7:88437245-88437267 GGACTTGGTGGCTCAGATAGGGG - Intergenic
1029599779 7:101556962-101556984 TGGGTGGGTGGATAAGTGAGTGG + Intronic
1033536634 7:142318680-142318702 TCAGATGGTGGATCAGATGGTGG - Intergenic
1044415899 8:91939214-91939236 TGAGTAGGTGGATCTTATAGTGG + Intergenic
1046881870 8:119318231-119318253 TGAGACGGTGGGTGAGATAGTGG - Intergenic
1047830026 8:128618969-128618991 TGAGTGGGTATATGAGATCGGGG - Intergenic
1048396755 8:134021254-134021276 TAAGTGGGTTGATGAGATAGAGG - Intergenic
1048569259 8:135637936-135637958 GGGGTGGGTGGACCAGATATAGG - Intronic
1048887292 8:138918581-138918603 ATGGTGGGTGGTTCAGATAGAGG - Intergenic
1049363040 8:142221697-142221719 TGAGTGAGTGGATGAGTGAGTGG - Intronic
1049363075 8:142222492-142222514 TGAGTGAGTGGATGAGTGAGTGG - Intronic
1049363080 8:142222616-142222638 TGAGTGAGTGGATGAGTGAGTGG - Intronic
1049363091 8:142222848-142222870 TGAGTGAGTGGATGAGTGAGTGG - Intronic
1052605454 9:30692477-30692499 TGTGTGTGTGTAACAGATAGTGG - Intergenic
1052662323 9:31449786-31449808 TGTGGGTGTGTATCAGATAGAGG - Intergenic
1053480963 9:38415884-38415906 TGAGTGGGTGGATCAGATAGAGG - Intronic
1053600657 9:39605440-39605462 TGAGTGTGTGGGTCAGTGAGTGG - Intergenic
1053858303 9:42359248-42359270 TGAGTGTGTGGGTCAGTGAGTGG - Intergenic
1054252872 9:62736989-62737011 TGAGTGTGTGGGTCAGTGAGTGG + Intergenic
1054566989 9:66771488-66771510 TGAGTGTGTGGGTCAGTGAGTGG + Intergenic
1057834953 9:98437310-98437332 TGAATGGGTGGATGAGTTTGTGG - Intronic
1185624504 X:1472872-1472894 TGAGTGGGTGGATGGGTTGGTGG + Intronic
1187191168 X:17036793-17036815 TGGGTGGGAGGAGGAGATAGAGG + Intronic
1196830613 X:119772790-119772812 TGAGTGGCTGGAGCAGAGTGAGG - Intergenic
1197424864 X:126283340-126283362 AGAGTGGGAGGAACAGAGAGAGG + Intergenic
1197550248 X:127884049-127884071 AGAGTGGGAGGGTGAGATAGGGG + Intergenic
1198586924 X:138132141-138132163 TGAATGTGTGGACCAGATAGAGG + Intergenic
1198703937 X:139426851-139426873 TGAGTGGATGGAACAAATAAAGG - Intergenic
1200685293 Y:6253180-6253202 TGATTTGCTGGATCATATAGTGG + Intergenic
1200990821 Y:9344421-9344443 TGATTTGCTGGATCATATAGTGG + Intergenic
1200993480 Y:9364715-9364737 TGATTTGCTGGATCATATAGTGG + Intronic
1200996143 Y:9385032-9385054 TGATTTGCTGGATCATATAGTGG + Intergenic
1201001313 Y:9473895-9473917 TGATTTGCTGGATCATATAGTGG + Intronic
1201003977 Y:9494199-9494221 TGATTTGCTGGATCATATAGTGG + Intergenic
1201006631 Y:9514511-9514533 TGATTTGCTGGATCATATAGTGG + Intergenic
1201009284 Y:9534817-9534839 TGATTTGCTGGATCATATAGTGG + Intergenic
1201961227 Y:19682568-19682590 TGGGTGGGTGGATCAAGTTGGGG - Intergenic