ID: 1053480964

View in Genome Browser
Species Human (GRCh38)
Location 9:38415896-38415918
Sequence GGTACAGCTGAATGAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480964_1053480972 -1 Left 1053480964 9:38415896-38415918 CCACCCACTCATTCAGCTGTACC 0: 1
1: 0
2: 1
3: 16
4: 180
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480964_1053480970 -2 Left 1053480964 9:38415896-38415918 CCACCCACTCATTCAGCTGTACC 0: 1
1: 0
2: 1
3: 16
4: 180
Right 1053480970 9:38415917-38415939 CCCATCTGAGGGCCCTCTGAAGG No data
1053480964_1053480973 2 Left 1053480964 9:38415896-38415918 CCACCCACTCATTCAGCTGTACC 0: 1
1: 0
2: 1
3: 16
4: 180
Right 1053480973 9:38415921-38415943 TCTGAGGGCCCTCTGAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480964 Original CRISPR GGTACAGCTGAATGAGTGGG TGG (reversed) Intronic
901240926 1:7692791-7692813 GGTACTGCTGAATGACAGGTGGG - Intronic
902261292 1:15226683-15226705 GGTACTTCTGAATGAGCTGGAGG - Intergenic
902402541 1:16166109-16166131 GACACAGCTGAAGGGGTGGGGGG - Intergenic
904029533 1:27525671-27525693 GGAACTGCTGGATGAGGGGGCGG + Intergenic
904811749 1:33167714-33167736 TGACAAGCTGAATGAGTGGGAGG - Intronic
905357932 1:37397731-37397753 TGTATAGGTGAGTGAGTGGGTGG + Intergenic
906458510 1:46019356-46019378 GGTACAGCTGTATGTCTGTGTGG + Intronic
906912598 1:49970995-49971017 GGCAAAGTTGAATGAGTGTGAGG + Intronic
908309576 1:62865397-62865419 TGTAAAGCTGAAAGAGAGGGTGG + Exonic
908643711 1:66254002-66254024 TGTACTGTTGAATGAGTTGGAGG - Intronic
909004528 1:70259216-70259238 GGTACAGGTAAATAAGTGGTGGG + Intergenic
910170380 1:84370811-84370833 GGGACAGCTGTGGGAGTGGGTGG + Intronic
913182615 1:116336815-116336837 GGTAATGCTGAGTGAGTGTGGGG + Intergenic
916555101 1:165887774-165887796 GCTACAGATGGATGGGTGGGGGG - Intronic
918537862 1:185594303-185594325 GGTACAGCTGAGCAAGTGGCAGG - Intergenic
918615738 1:186541570-186541592 GGACCAGGTGAATGAGTGAGTGG - Intergenic
919891980 1:201982509-201982531 GGTGCAGCTAGAAGAGTGGGCGG + Intronic
922558385 1:226549661-226549683 GGTACCCCTGAATGAGGCGGAGG - Intronic
1064768565 10:18699674-18699696 GGAAAAGCTGAATGAGTTAGAGG + Intergenic
1065178834 10:23104862-23104884 GGTAGGTCTGAATGAATGGGTGG - Intronic
1065648317 10:27860603-27860625 GGTACAGTTGAATGACTTTGTGG - Exonic
1065917420 10:30365200-30365222 GGTGGACCTGAAGGAGTGGGTGG - Intronic
1066029321 10:31402402-31402424 AGAAGAGCTGTATGAGTGGGAGG + Intronic
1072658249 10:97345739-97345761 GCTGGAGCTGAGTGAGTGGGAGG - Intergenic
1074943945 10:118262786-118262808 AGTTCAGCTGCATCAGTGGGTGG + Intergenic
1076007081 10:126956428-126956450 GGTGCAGCTGAGTGAGTGGGAGG + Intronic
1076420836 10:130330527-130330549 GGGCCAGGTGGATGAGTGGGCGG + Intergenic
1076573780 10:131450468-131450490 GTTACAGCTGCATGGCTGGGTGG - Intergenic
1076815329 10:132911773-132911795 GGGACGGCTGCATGTGTGGGTGG + Intronic
1077159442 11:1106055-1106077 TGCACAGGTGGATGAGTGGGTGG - Intergenic
1077612419 11:3651712-3651734 AGTACAGCTGAAGGAGCTGGGGG - Intronic
1077915180 11:6607015-6607037 CGTACAGCTGAAGGGGTTGGGGG - Intronic
1078954810 11:16180312-16180334 ACTACAGTTCAATGAGTGGGAGG + Intronic
1083380169 11:62260918-62260940 AGTACAGCTCACTGGGTGGGGGG + Intergenic
1085570480 11:77554023-77554045 AGTACAGCTGAAGGAGCCGGGGG - Intronic
1086550471 11:88047170-88047192 AGTACAGCTGAAGGAGCCGGGGG - Intergenic
1087307076 11:96500601-96500623 GCCACAGCTGAATGAGAAGGAGG - Intronic
1089783677 11:120892728-120892750 TGTACAACTGAATGAGTGTCAGG - Intronic
1090657012 11:128854045-128854067 GGTGCAGGTGGATGGGTGGGTGG - Intronic
1092197776 12:6560305-6560327 GGTAGAAGAGAATGAGTGGGTGG - Exonic
1095100811 12:38181652-38181674 GGTACAGCTGAAATACTGGATGG + Intergenic
1096668086 12:53180555-53180577 GGTGCAGCTGGGTGAGTGGGCGG - Exonic
1097065617 12:56318369-56318391 GGTACAGCTGAAGGGCTGTGCGG + Exonic
1099553975 12:84086034-84086056 AGGACAGCCAAATGAGTGGGTGG + Intergenic
1105736666 13:23278621-23278643 TGTGTAGCTGAGTGAGTGGGAGG + Intronic
1106595089 13:31128815-31128837 GTTGCAGCTGAATGAGTGTGAGG - Intergenic
1107561099 13:41558332-41558354 TGGACAGATAAATGAGTGGGTGG - Intergenic
1115642729 14:35345069-35345091 AATACAGATGAATGAGTGGATGG - Intergenic
1117209299 14:53478841-53478863 TGTACAGCAGAGTGATTGGGTGG - Intergenic
1119900118 14:78252354-78252376 GGTAAAGATGAAAGAGAGGGAGG + Intronic
1123937538 15:25201280-25201302 GGTACTGCTGGATGCATGGGTGG + Intergenic
1129164591 15:73769272-73769294 GGGGCAGTTGTATGAGTGGGTGG + Intergenic
1130801436 15:87267584-87267606 GGTACAGCAAAATGAGTGAGGGG - Intergenic
1132558649 16:583705-583727 GGTACGGCTGGGTCAGTGGGCGG - Exonic
1134687928 16:16171746-16171768 TGGACAGATAAATGAGTGGGTGG + Intronic
1134687937 16:16171796-16171818 TGGACAGATAAATGAGTGGGTGG + Intronic
1134688010 16:16172092-16172114 GGGATGGCTAAATGAGTGGGTGG + Intronic
1134688070 16:16172350-16172372 GGGATGGCTAAATGAGTGGGTGG + Intronic
1134688075 16:16172371-16172393 GGGATGGCTAAATGAGTGGGTGG + Intronic
1134688080 16:16172392-16172414 GGGATGGCTAAATGAGTGGGTGG + Intronic
1134688085 16:16172413-16172435 GGGATGGCTAAATGAGTGGGTGG + Intronic
1135507460 16:23051337-23051359 GGTACAGGTGGATGAGAGGCTGG - Intergenic
1135943494 16:26843244-26843266 GGCACAGCTGAAAGATTGGCAGG + Intergenic
1136279121 16:29197744-29197766 GGTACAGACGGATGAGTGGATGG + Intergenic
1137530420 16:49275710-49275732 GGTAAGGCTGAATGAAGGGGTGG + Intergenic
1140328854 16:74032582-74032604 GGTACAGAGGAGTGGGTGGGTGG - Intergenic
1141935837 16:87237199-87237221 GGTGCAGCTGGAGGTGTGGGAGG - Intronic
1143948413 17:10614421-10614443 GGTGCAGGTGAGTGAGTGGAAGG + Intergenic
1145262496 17:21362991-21363013 TGAACAGATGAATGAGTGGATGG + Intergenic
1147718109 17:42521646-42521668 GGTCCAGCTGAATGCCAGGGGGG - Exonic
1151251339 17:72837939-72837961 GGTACTGCTCAAAGAGTGTGGGG + Intronic
1152034146 17:77861671-77861693 TGGACAGATGAATGAATGGGTGG + Intergenic
1152118860 17:78405850-78405872 GGAAGAGCTGAGTGAGTGGGGGG + Intronic
1152767382 17:82148649-82148671 TGAATAGATGAATGAGTGGGTGG + Intronic
1152870027 17:82748848-82748870 TGTCCAGGTGAATGAGTGGCAGG + Exonic
1154307796 18:13243450-13243472 AGGACAGATGAACGAGTGGGTGG - Intronic
1154307815 18:13243533-13243555 TGGACAGATGAATGAGTGGATGG - Intronic
1154307901 18:13243879-13243901 TGGAGAGATGAATGAGTGGGTGG - Intronic
1155885148 18:31198660-31198682 TGTAAAGCAGAATCAGTGGGTGG - Intergenic
1158172569 18:54616078-54616100 GCTACAGCAGAGTGAGTGAGAGG + Intergenic
1159164711 18:64685407-64685429 AGTACAGCTGAAGGAGCCGGGGG - Intergenic
1159922718 18:74240376-74240398 GGTACTGCTTAATGCATGGGTGG + Intergenic
1160903873 19:1443005-1443027 GGTCCAGCTCAAGGAGAGGGAGG + Intergenic
1160926553 19:1549478-1549500 TGAACAGGTGGATGAGTGGGTGG - Intergenic
1161372977 19:3924001-3924023 TGGACAGATGGATGAGTGGGTGG + Intronic
1161620317 19:5293787-5293809 GGTCCAGGGGAATGAATGGGGGG + Intronic
1162137662 19:8565689-8565711 GGCACAGCTGTGTCAGTGGGTGG + Intronic
1163493881 19:17633370-17633392 GGGACAAATGGATGAGTGGGTGG - Intronic
1165077647 19:33289717-33289739 GGTCCAGTGGCATGAGTGGGTGG + Intergenic
1165144416 19:33722216-33722238 GGATGAGCTGAATGAATGGGTGG + Intronic
1166566556 19:43769152-43769174 CGAAGAGCTGAAAGAGTGGGAGG + Intronic
1167016167 19:46842492-46842514 GGAACAACTGAATGAATGGGCGG + Intronic
1167026284 19:46921381-46921403 GGAACAGCTAACTGAGGGGGAGG + Exonic
1167102775 19:47414471-47414493 GGTGTAGCTGAATCTGTGGGTGG + Intronic
1168340470 19:55620548-55620570 GGTTCAGCTGTAGGAGAGGGGGG - Intergenic
1168635156 19:57990429-57990451 GGGAAAGCTGAAGAAGTGGGAGG + Intronic
928767144 2:34660985-34661007 TGCACAGCTGAATGTGAGGGTGG - Intergenic
930374429 2:50547202-50547224 GGTACAGCTGATTGTGTCAGCGG - Intronic
932757374 2:74417870-74417892 GGCACATGTGTATGAGTGGGTGG + Intronic
932806607 2:74789793-74789815 GGTACAGCTGAGTGAGAGGTGGG - Intergenic
937288386 2:120767278-120767300 GGTACAGCTGAGTGAGAGGCCGG + Intronic
938661579 2:133492240-133492262 GGTGGGGCTGAATTAGTGGGTGG - Intronic
941952782 2:171173995-171174017 TGGACAGATGAATGAATGGGAGG - Intronic
943558169 2:189430328-189430350 GATACAGCTACATGAGTGAGAGG + Intergenic
945318329 2:208393895-208393917 GGTAGAGCTGGAGGAGTGGATGG + Intronic
945994940 2:216428612-216428634 GGTCCAGCTGAACTTGTGGGAGG - Exonic
948765686 2:240217571-240217593 GGTGGAGCTGAAAGAGTGGGCGG - Intergenic
1168928792 20:1604661-1604683 AGTAGAGCTGGATGAGTGGAGGG + Intronic
1168969587 20:1921771-1921793 AGTAGAGCTGGATGAGTGGAGGG - Intronic
1169527269 20:6442857-6442879 GGTACAGCTGAAATACTGGATGG - Intergenic
1171250760 20:23645282-23645304 CGTACAGCTGAAGGCCTGGGTGG - Intergenic
1172616382 20:36288289-36288311 GGTAGAGAGGGATGAGTGGGTGG - Intergenic
1174302407 20:49592220-49592242 AGGACAGATGAATGGGTGGGTGG - Intergenic
1174421248 20:50400446-50400468 GCTGCAGCAGAATGAGTGAGGGG + Intergenic
1175245058 20:57577193-57577215 GGGAGGGGTGAATGAGTGGGTGG + Intergenic
1175372418 20:58500896-58500918 GGTGCATCTGGAGGAGTGGGAGG - Intronic
1179708188 21:43194460-43194482 GGGCCACCTGAAGGAGTGGGGGG + Intergenic
1179828993 21:43984217-43984239 GGCACAGCTGCCCGAGTGGGCGG - Exonic
1181003178 22:19997562-19997584 GCTACAGCTGCAGCAGTGGGTGG + Intronic
1183402689 22:37613914-37613936 GGTCCAGCTGCAGGGGTGGGAGG + Intronic
1183953983 22:41368418-41368440 GGCACAGCAGGATGAGAGGGAGG - Intronic
1184951602 22:47846975-47846997 TGTCCTGCTGAATGAATGGGAGG - Intergenic
949161859 3:892600-892622 AGTACAGCTGAAGGAGCCGGGGG + Intergenic
950665695 3:14493561-14493583 CCAACAGATGAATGAGTGGGTGG + Exonic
951355824 3:21665518-21665540 GGTACAGCTGCCTGAGTTCGAGG - Intronic
951628073 3:24688587-24688609 GATACAGCTAAATGAGGGGCAGG + Intergenic
952186327 3:30973549-30973571 GATTCAGCTGAGTGAGTGGGGGG - Intergenic
954395685 3:50292174-50292196 GGGACAGCTGTATGAGCGGCGGG - Intronic
956603499 3:71048811-71048833 GGTACAGCTGGAGGTGGGGGAGG + Intronic
956977397 3:74597071-74597093 GTTACAACTTAATGAGAGGGGGG + Intergenic
958070593 3:88605785-88605807 GGTTCAGGAGAAAGAGTGGGAGG + Intergenic
959936603 3:112036125-112036147 GTTACAGCTTCATGACTGGGTGG - Intronic
960198594 3:114802591-114802613 GGGACAACTGAATGAGAGGAGGG + Intronic
960536738 3:118823560-118823582 AAAACAGCTGAATGAGAGGGAGG + Intergenic
965502204 3:169470557-169470579 GGTACAGGTGTATGAGGGGGAGG + Intronic
965772416 3:172194548-172194570 GGTACTGCTAAATGGGTTGGTGG + Intronic
967070066 3:185955180-185955202 GGTACAGCCAAAGGACTGGGTGG - Intergenic
969205427 4:5640371-5640393 TGAATAGATGAATGAGTGGGTGG + Intronic
969624427 4:8295119-8295141 TAGACAGGTGAATGAGTGGGTGG - Intronic
969865559 4:10074996-10075018 TGTACAGGTGAATGAGCCGGGGG - Exonic
971250103 4:24967433-24967455 GGTACAGCTGCATGCGAAGGGGG - Intronic
972644556 4:40955038-40955060 GGTACAGAAGAATGAGTAAGTGG - Intronic
973237692 4:47923025-47923047 GGTACAGCTGAAGCAGGGCGGGG - Intronic
973567222 4:52200565-52200587 GGCACATCTGAAAGTGTGGGGGG + Intergenic
975426526 4:74235412-74235434 AGTAAAGATGAGTGAGTGGGAGG + Intronic
975783789 4:77866593-77866615 GTTACAGCAGAGTGAGTGTGAGG - Intronic
981950812 4:150404608-150404630 GATATAGCTGAAAGTGTGGGGGG - Intronic
984380094 4:178981997-178982019 GGAACAGATTAATAAGTGGGAGG + Intergenic
987047734 5:14123484-14123506 GGTATAGCTGAGGGAGGGGGTGG + Intergenic
988199356 5:28049630-28049652 GGTACAGCTGAAGGAGCTGGGGG - Intergenic
988417693 5:30966854-30966876 GGGTCAGCTGACTGAGGGGGTGG - Intergenic
997319140 5:132963517-132963539 GGGACAGCTGACTGAGGCGGCGG + Exonic
997424054 5:133791047-133791069 GCTACAGCAGAGTGAGTGAGGGG - Intergenic
1001397592 5:171428286-171428308 GGCACAGATGAGTGGGTGGGGGG - Intronic
1003233001 6:4271782-4271804 GGAACAGCTGGATGAGAGTGGGG - Intergenic
1005988997 6:30891844-30891866 GGGCCAGCTGCATGAGTGTGAGG + Intronic
1022035258 7:26527950-26527972 GGTCCAGCTTCATCAGTGGGGGG + Intergenic
1023106471 7:36767892-36767914 TGTACAATTGAGTGAGTGGGGGG - Intergenic
1025249582 7:57343022-57343044 GCTGCAGCAGAATGAGTGAGGGG - Intergenic
1026338922 7:69418943-69418965 GTTAGGGCTGAATCAGTGGGTGG - Intergenic
1026441771 7:70451098-70451120 GCTATAGGGGAATGAGTGGGAGG + Intronic
1027263582 7:76481629-76481651 GTTACAGCTGAGTGGGTGGGAGG + Intronic
1027314954 7:76979741-76979763 GTTACAGCTGAGTGGGTGGGAGG + Intergenic
1028763724 7:94526247-94526269 GGAACTGCTGAATGACTGTGTGG - Intronic
1029799564 7:102932404-102932426 GATAGAGATGAATGAGTGGGTGG - Intronic
1030562120 7:111101712-111101734 GGTATAGCTAAATGAGTTAGGGG + Intronic
1033134758 7:138775118-138775140 GGTACCCCAGAATGAGTGAGGGG + Intronic
1036070665 8:5438366-5438388 AGTACAGCTGAAGGAGCCGGGGG + Intergenic
1036143185 8:6227069-6227091 GCTGCTGCAGAATGAGTGGGTGG - Intergenic
1039274918 8:35924792-35924814 TCTACACCTGAATGTGTGGGAGG + Intergenic
1039310029 8:36307487-36307509 GGTGCCCCTGAGTGAGTGGGTGG + Intergenic
1043252078 8:78087555-78087577 GGTACAGGTGAAGGATTGGGTGG + Intergenic
1045777734 8:105825446-105825468 GAAACAGCAGAATGAGTGAGTGG - Intergenic
1046942311 8:119943142-119943164 GGTTCAGCTCAGTCAGTGGGAGG + Intronic
1049354226 8:142179716-142179738 GGGACTGCTGAATGAGTGCCAGG + Intergenic
1051086005 9:13349755-13349777 GGGAAAGCTGCATGTGTGGGGGG - Intergenic
1052576465 9:30298604-30298626 CTTAGAGCTGAATGAGTGAGAGG + Intergenic
1053096984 9:35337198-35337220 GGTAAAGAGGAGTGAGTGGGAGG + Intronic
1053480964 9:38415896-38415918 GGTACAGCTGAATGAGTGGGTGG - Intronic
1056731825 9:89172619-89172641 GGAACAGCCTACTGAGTGGGTGG - Intronic
1056877274 9:90345917-90345939 GATACAGCAACATGAGTGGGGGG - Intergenic
1058119275 9:101120549-101120571 GGTGCAGTTGAATAAATGGGTGG + Intronic
1059410128 9:114126725-114126747 GCTACAGCTGAGGAAGTGGGAGG - Intergenic
1059853569 9:118370013-118370035 GGTACTGCTTAATGAGTGTGGGG + Intergenic
1060241758 9:121909842-121909864 GGTAGAGCTGAGTGGGTGGCAGG + Intronic
1062083170 9:134635130-134635152 GGAACAGCCCATTGAGTGGGAGG + Intergenic
1062247726 9:135578064-135578086 TGGACAGGTGAATGGGTGGGTGG - Intergenic
1062247795 9:135578410-135578432 TGGACAGGTGAATGGGTGGGTGG - Intergenic
1062247864 9:135578756-135578778 TGGACAGGTGAATGGGTGGGTGG - Intergenic
1185624932 X:1474673-1474695 TGGACAGATGGATGAGTGGGAGG + Intronic
1185624993 X:1474971-1474993 TGGACAGATGGATGAGTGGGAGG + Intronic
1185750460 X:2606979-2607001 GGTAGAGATAGATGAGTGGGTGG - Intergenic
1185883372 X:3759834-3759856 TGGACAGATGAATGGGTGGGTGG - Intergenic
1189853095 X:45196267-45196289 GGGTCACCTGAATGAATGGGTGG + Intronic
1194763785 X:97825615-97825637 GGTGCAGCTAAAGGAGTAGGAGG + Intergenic
1196125627 X:112095755-112095777 GGTATGGCTGTAAGAGTGGGTGG + Intergenic
1196220760 X:113110652-113110674 GGTACAACTGAAGGAGCCGGGGG + Intergenic
1197164579 X:123362521-123362543 GGTAGAGCAGAATGAGTGACAGG + Intronic