ID: 1053480965

View in Genome Browser
Species Human (GRCh38)
Location 9:38415899-38415921
Sequence ATGGGTACAGCTGAATGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 540}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480965_1053480972 -4 Left 1053480965 9:38415899-38415921 CCCACTCATTCAGCTGTACCCAT 0: 1
1: 0
2: 1
3: 21
4: 540
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480965_1053480973 -1 Left 1053480965 9:38415899-38415921 CCCACTCATTCAGCTGTACCCAT 0: 1
1: 0
2: 1
3: 21
4: 540
Right 1053480973 9:38415921-38415943 TCTGAGGGCCCTCTGAAGGGTGG No data
1053480965_1053480970 -5 Left 1053480965 9:38415899-38415921 CCCACTCATTCAGCTGTACCCAT 0: 1
1: 0
2: 1
3: 21
4: 540
Right 1053480970 9:38415917-38415939 CCCATCTGAGGGCCCTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480965 Original CRISPR ATGGGTACAGCTGAATGAGT GGG (reversed) Intronic
900841013 1:5048629-5048651 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
901776085 1:11561219-11561241 ATGGGGAGAGCTGAAGGAGTTGG + Intergenic
904711865 1:32436120-32436142 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
904996257 1:34633885-34633907 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
905011650 1:34751156-34751178 ATGGGTAGAGCTGGTGGAGTAGG + Intronic
905128048 1:35729752-35729774 ATGGGTAGAGCTGAGTGGGAAGG - Intronic
905357931 1:37397728-37397750 ATGTGTATAGGTGAGTGAGTGGG + Intergenic
905500012 1:38428851-38428873 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
905941881 1:41869755-41869777 ATGTGTACAGTCTAATGAGTTGG - Intronic
906081149 1:43089285-43089307 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
907292855 1:53428074-53428096 GTGAGTACAGCTGAAGGAGCGGG - Intergenic
907503342 1:54899796-54899818 GTGAGTACAGCTGAAGGAGCGGG + Intergenic
907521491 1:55026379-55026401 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
908852640 1:68390048-68390070 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
909223430 1:72989741-72989763 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
909550801 1:76896704-76896726 GTGAGTACAGCTGAAGGAGCCGG + Intronic
909792752 1:79698291-79698313 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
909978221 1:82069448-82069470 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
909988065 1:82186716-82186738 ATGGTTCTAGCTGGATGAGTGGG + Intergenic
913066291 1:115258541-115258563 ATGGGTACTGCTGATTGGTTAGG - Intergenic
914318973 1:146541208-146541230 ATGGGTGCTGCTGATTGATTGGG - Intergenic
914495384 1:148192149-148192171 ATGGGTGCTGCTGATTGATTGGG + Intergenic
916272916 1:162963115-162963137 ATGGGTACTGCTGATTGGTTGGG - Intergenic
918347347 1:183617429-183617451 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
918542195 1:185644647-185644669 ATGGGTACTGCTGATTGGCTGGG + Intergenic
918567440 1:185950225-185950247 GTGAGTACAGCTGAAGGAGCCGG + Intronic
919201975 1:194366845-194366867 AAGGGTAGAGATGAGTGAGTGGG - Intergenic
919476634 1:198038558-198038580 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
919868904 1:201805408-201805430 ATGGGTAGAGAGGAATGTGTTGG + Intronic
920677423 1:208048001-208048023 ATGGGTACAGCTGAGCCAGGGGG + Intronic
920874717 1:209823470-209823492 ATGGGTACAGATGAATGGAAAGG + Intergenic
921222474 1:212982885-212982907 ATGCATTCAGCTTAATGAGTAGG + Intronic
921496529 1:215849026-215849048 ATGGAAACAGCTGAATGAAGAGG + Intronic
921732746 1:218595728-218595750 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
922049308 1:221975034-221975056 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
922632278 1:227128127-227128149 ATGGCTAGAGCAGAATGAGCAGG - Intronic
922877312 1:228950014-228950036 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
922906622 1:229178211-229178233 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
923075459 1:230605164-230605186 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
923770514 1:236934195-236934217 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
923963017 1:239105144-239105166 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1063363415 10:5475100-5475122 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1064886767 10:20121098-20121120 GTGAGTACAGCTGAAGGAGCTGG + Intronic
1065442895 10:25770680-25770702 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1066821414 10:39495740-39495762 ATAGGTACAACTGTGTGAGTTGG - Intergenic
1067894022 10:50160499-50160521 GTGGGAACAGCTCAATGATTTGG + Intergenic
1067954826 10:50779765-50779787 GTGGGAACAGCTCAATGATTTGG - Intronic
1068058120 10:52035695-52035717 GTGGGTACAGCTGAAGGAGCCGG + Intronic
1071897514 10:90082968-90082990 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1071916432 10:90298774-90298796 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1071987983 10:91072124-91072146 ATGGATACAGTTGACTGAATTGG + Intergenic
1073709256 10:106019560-106019582 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1074298598 10:112213111-112213133 ATAGGCCCAGCTGAATGAATGGG + Intronic
1074741036 10:116484593-116484615 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1075248934 10:120848621-120848643 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1077349394 11:2085472-2085494 GAGGACACAGCTGAATGAGTGGG + Intergenic
1077612422 11:3651715-3651737 GTGAGTACAGCTGAAGGAGCTGG - Intronic
1077766158 11:5162212-5162234 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1077883620 11:6369793-6369815 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1078045910 11:7914096-7914118 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1079230784 11:18647032-18647054 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1079672337 11:23185869-23185891 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1079726854 11:23889120-23889142 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1079847418 11:25488945-25488967 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1080027683 11:27631011-27631033 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1080181269 11:29429248-29429270 AAGGTAACAGCTGAATGAGGGGG - Intergenic
1081177624 11:39947965-39947987 ATTGGTACACCTGAAAGAGATGG + Intergenic
1082064440 11:47887964-47887986 ATGTGTACAGATGTATGTGTGGG - Intergenic
1083261662 11:61526404-61526426 ATGGGTTCTGATGGATGAGTAGG - Intronic
1083534641 11:63456689-63456711 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1084232531 11:67763444-67763466 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1084355782 11:68637481-68637503 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1084555203 11:69872005-69872027 ATGGGTCCAGGTGAGTGTGTTGG - Intergenic
1085169367 11:74435450-74435472 GTGGGAACATCTGAAAGAGTTGG - Intergenic
1085570483 11:77554026-77554048 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1085934506 11:81125568-81125590 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1085977138 11:81670915-81670937 ATGTGAAAAGCTAAATGAGTTGG + Intergenic
1086134570 11:83433334-83433356 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1086507806 11:87524202-87524224 ATGGGTACTGCTGATTGGTTGGG - Intergenic
1086550474 11:88047173-88047195 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1086665597 11:89477507-89477529 CTGGGGACCGCTGAAAGAGTGGG + Intronic
1087099317 11:94349495-94349517 ATGAGTACAGCTGAAGGAGCCGG - Intergenic
1087099897 11:94353619-94353641 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1087728421 11:101750544-101750566 ATGGGTACTGATGGAGGAGTAGG + Intronic
1087839275 11:102905807-102905829 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1088555217 11:111054179-111054201 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1089987904 11:122830894-122830916 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1090107337 11:123867303-123867325 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1090358212 11:126154875-126154897 ATGGGTCCTGCTGAGTGAGAAGG - Intergenic
1090526545 11:127544459-127544481 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1090546235 11:127770802-127770824 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1090750209 11:129739995-129740017 AAGTGTGCAGCTGGATGAGTAGG + Intergenic
1090871736 11:130755444-130755466 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1092626523 12:10334861-10334883 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1092789939 12:12062165-12062187 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1092924557 12:13261520-13261542 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1093321759 12:17722131-17722153 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1093358718 12:18199103-18199125 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1093579046 12:20767146-20767168 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1094583600 12:31757058-31757080 ATGGGTACTGCTGAGTGATCAGG + Intergenic
1095501962 12:42849168-42849190 ATGAGAACAACTGAAAGAGTTGG - Intergenic
1095778456 12:46034131-46034153 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1096613851 12:52820478-52820500 TTGGGTACAGCTTGAGGAGTGGG + Intergenic
1097398814 12:59105611-59105633 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1098194963 12:67989963-67989985 ATGGTCACAGGTGGATGAGTTGG + Intergenic
1098402485 12:70089182-70089204 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1098629289 12:72707134-72707156 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1098653562 12:73003735-73003757 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1098920184 12:76295609-76295631 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1099188945 12:79543643-79543665 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1099291869 12:80785013-80785035 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1100940577 12:99719279-99719301 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1101278167 12:103224611-103224633 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1106374060 13:29166913-29166935 ATTGGAAAAACTGAATGAGTAGG - Intronic
1108814357 13:54270641-54270663 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1108919321 13:55656894-55656916 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1109343859 13:61092516-61092538 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1110650226 13:77935052-77935074 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1110845574 13:80187459-80187481 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1110900351 13:80814790-80814812 ATGGGTGGGTCTGAATGAGTAGG + Intergenic
1111125811 13:83910214-83910236 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1111302274 13:86362187-86362209 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1111361878 13:87188353-87188375 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1111458610 13:88514760-88514782 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1111631474 13:90850519-90850541 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1111724668 13:91991470-91991492 ATGGGCTCATTTGAATGAGTGGG + Intronic
1112117699 13:96375031-96375053 ATGGCTACAGCACAGTGAGTAGG - Intronic
1112237092 13:97646287-97646309 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1113324585 13:109269287-109269309 ATGAGTACAGCTGAAGGAGCCGG - Intergenic
1114996146 14:28354685-28354707 ATTGGTACAGTGGAAGGAGTGGG - Intergenic
1115617658 14:35111818-35111840 ATGGGTACTGCTGATTGGTTGGG - Intronic
1116534545 14:46014354-46014376 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1116573682 14:46547694-46547716 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1116703063 14:48264298-48264320 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1117801413 14:59447860-59447882 GTGAGTACAGCTGAAGGAGCTGG - Intronic
1118936977 14:70297352-70297374 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1119022648 14:71128090-71128112 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1119317428 14:73707270-73707292 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1119854728 14:77891035-77891057 CTGGGTACAGATGAGTGTGTGGG + Intronic
1120251129 14:82062808-82062830 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1120466688 14:84866779-84866801 ATGTGTGCAGCTTAATAAGTTGG + Intergenic
1120539332 14:85734903-85734925 GTGAGTATAGCTGAAGGAGTTGG + Intergenic
1120659670 14:87236592-87236614 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1121703915 14:95976942-95976964 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1121936649 14:98025768-98025790 AGGGGGACAGGGGAATGAGTTGG + Intergenic
1122041224 14:98988978-98989000 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1126529920 15:49701070-49701092 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1126912182 15:53428770-53428792 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1127120829 15:55770739-55770761 ATGGGGACAGGTTAATGAGGAGG - Intergenic
1127181672 15:56426155-56426177 ATGGGAACAGCTGCATCATTTGG - Intronic
1130855334 15:87835050-87835072 GTGAGTACAGCTGAAGGAGCAGG - Intergenic
1131209169 15:90478750-90478772 AGGGATACAGTTGAATGAGAAGG + Intronic
1131448001 15:92515493-92515515 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1131684408 15:94754553-94754575 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1131882285 15:96873751-96873773 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1132263276 15:100444282-100444304 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1132340654 15:101076321-101076343 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1133765496 16:8834960-8834982 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1133766501 16:8841857-8841879 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1133948553 16:10370211-10370233 ATGGGTTCTGCTGATTGATTAGG + Intronic
1134450420 16:14359905-14359927 ATCTGTACAGCTGGAGGAGTGGG - Intergenic
1135093401 16:19540426-19540448 ATGGGATCTGTTGAATGAGTGGG + Intronic
1136455198 16:30376341-30376363 ATGGGATCAGCTGAATTAGTGGG + Intronic
1137570475 16:49563076-49563098 ATGCGTACAGCTGGCTGTGTGGG - Intronic
1138002154 16:53292868-53292890 GTGGTTAAAGCTGATTGAGTAGG - Exonic
1138758866 16:59519568-59519590 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1138805178 16:60082613-60082635 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1139039008 16:62981076-62981098 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1139230354 16:65277183-65277205 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1139943490 16:70622726-70622748 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1140328855 16:74032585-74032607 ATGGGTACAGAGGAGTGGGTGGG - Intergenic
1141864972 16:86743960-86743982 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1142896518 17:2982651-2982673 ATAATTACAACTGAATGAGTGGG + Intronic
1144210945 17:13014997-13015019 ATGGGTACAGATGGAAGTGTGGG + Intronic
1146133785 17:30300444-30300466 ATGGGTTCAGCTGATTGGTTGGG + Intergenic
1149448866 17:56733915-56733937 AAGGGTCCACATGAATGAGTTGG - Intergenic
1151094850 17:71485268-71485290 CTGTGTACAGCTAAATGATTGGG + Intergenic
1151622717 17:75256349-75256371 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1155174093 18:23288040-23288062 GTGAGTACAGCTGAAGGAGCAGG - Intronic
1155696785 18:28695043-28695065 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1156237627 18:35219761-35219783 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1156251669 18:35358048-35358070 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1156817135 18:41325047-41325069 ATGGGTGCAGCTGATTGTTTGGG + Intergenic
1156916060 18:42465396-42465418 GTGAGTATAGCTGAAGGAGTCGG - Intergenic
1156938759 18:42740429-42740451 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1159164714 18:64685410-64685432 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1159835273 18:73328422-73328444 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1162583591 19:11545576-11545598 ATGGAGAGAGCTGAATGAGATGG + Intronic
1163132337 19:15282642-15282664 AAGGGCACAGCTGAGTCAGTGGG - Intronic
1163487527 19:17597207-17597229 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1164220291 19:23187248-23187270 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1166219622 19:41356039-41356061 ATGGCTAGAGCAGAATGAGGTGG + Intronic
1166498702 19:43325439-43325461 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1166531670 19:43546684-43546706 CTGGGTCCAGCTGCCTGAGTGGG + Exonic
1166926866 19:46275054-46275076 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1167876119 19:52414163-52414185 ATGGGGAAACCTGGATGAGTCGG - Intronic
1168211898 19:54896825-54896847 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1168248486 19:55126800-55126822 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
925438904 2:3867172-3867194 ATGGGTGCTGCCGAATGATTGGG - Intergenic
925552592 2:5092725-5092747 ATGGCTACAGCTCAGTGAGGTGG + Intergenic
926413819 2:12630283-12630305 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
926815314 2:16793867-16793889 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
928770589 2:34699038-34699060 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
928771027 2:34702129-34702151 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
928857401 2:35816867-35816889 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
928928800 2:36602815-36602837 GTGAGTACAGCTGAAGGAGCCGG - Intronic
929076441 2:38082696-38082718 CTGAGTACAGCTGAAGGAGCCGG + Intronic
930706460 2:54509342-54509364 GTGAGTACAGCTGAAGGAGCCGG + Intronic
930955324 2:57196736-57196758 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
930983071 2:57551335-57551357 ATGGGTACTGCTGATTGGTTGGG - Intergenic
931237167 2:60421382-60421404 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
931948517 2:67335593-67335615 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
932367967 2:71164928-71164950 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
932853980 2:75215701-75215723 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
932973686 2:76575568-76575590 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
933013319 2:77092157-77092179 GTGAGTACAGCTGAAGGAGCCGG - Intronic
933079492 2:77968886-77968908 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
935146120 2:100396685-100396707 ATGGGGACAGGTGCATGAATGGG - Intronic
939307635 2:140429917-140429939 GTGAGTACAGCTGAAGGAGCCGG - Intronic
939309553 2:140457554-140457576 ATGGGCACGGCTGAGTGACTTGG + Exonic
940173368 2:150852058-150852080 ATGGGTGCTGCTGAATGTTTGGG + Intergenic
940183990 2:150962461-150962483 GTGAGTACAGCTGAAGGAATTGG - Intergenic
940530420 2:154871094-154871116 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
940675583 2:156721999-156722021 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
941340624 2:164299629-164299651 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
941353613 2:164462895-164462917 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
941750847 2:169134324-169134346 GTGAGTACAGCTGAAGGAGCTGG - Intronic
941935629 2:170979358-170979380 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
943412695 2:187562416-187562438 GTGAGTACAGCTGAAGGAGCCGG + Intronic
943421349 2:187672419-187672441 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
943835627 2:192511252-192511274 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
943865602 2:192922050-192922072 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
943951038 2:194132606-194132628 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
944028295 2:195198915-195198937 ATGTGTACACATGAATGTGTTGG - Intergenic
945301193 2:208217789-208217811 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
946886729 2:224229070-224229092 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
947395812 2:229685961-229685983 ATGGGTAGAGCTGAAAGAAGAGG + Intronic
947903358 2:233741309-233741331 CTGGGTAGAGTAGAATGAGTTGG - Intronic
948765687 2:240217574-240217596 GTGGGTGGAGCTGAAAGAGTGGG - Intergenic
948765724 2:240217721-240217743 ATGGGTGGAGCTGAAGGGGTGGG - Intergenic
1168739530 20:176013-176035 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1168840288 20:905716-905738 CTCGGCACATCTGAATGAGTTGG - Intronic
1169758276 20:9066370-9066392 ATGTCTGCAGCTGCATGAGTAGG + Intergenic
1170106462 20:12757657-12757679 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1170165967 20:13360730-13360752 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1170680175 20:18519320-18519342 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1170750656 20:19141909-19141931 AAGAGTACAGAAGAATGAGTGGG - Intergenic
1170820470 20:19753088-19753110 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1173102137 20:40097113-40097135 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1173611368 20:44370732-44370754 ATGGGGACAGCTGAGTCAGTAGG + Intronic
1173652334 20:44674517-44674539 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1173781946 20:45763439-45763461 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1174118803 20:48247075-48247097 ATGGGCCCAGCTGAGTGTGTTGG + Intergenic
1175070737 20:56331763-56331785 ATGGGTGCAGCTGATTGGATCGG - Intergenic
1175200775 20:57275939-57275961 ATGAGTCCAGCTCAAGGAGTGGG - Intergenic
1175648430 20:60695707-60695729 ATGGGTGCTGCTGATTGATTGGG + Intergenic
1175792255 20:61747026-61747048 ATGGGCACAGCTGAAGGCCTGGG - Intronic
1177030907 21:15981519-15981541 GTGAGTACAGCTGAAGGAGTCGG + Intergenic
1177102939 21:16917979-16918001 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1177281133 21:18984483-18984505 ATGTGTACTGCTGATTGATTGGG - Intergenic
1177840487 21:26229744-26229766 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1178001421 21:28164983-28165005 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1179014992 21:37588658-37588680 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1179650101 21:42802761-42802783 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1182732509 22:32506552-32506574 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1182778147 22:32846221-32846243 ATGGGTACATGTGATAGAGTAGG + Intronic
1182998830 22:34838095-34838117 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1183402688 22:37613911-37613933 ATGGGTCCAGCTGCAGGGGTGGG + Intronic
949161856 3:892597-892619 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
949419150 3:3846666-3846688 GTGGGTACAGCTCATTTAGTGGG - Exonic
949539457 3:5020725-5020747 ATGGGTACAGAGGCATGAATTGG + Intergenic
949594955 3:5533183-5533205 ATGGGAAAGGGTGAATGAGTGGG - Intergenic
949827671 3:8180790-8180812 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
950926718 3:16748096-16748118 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
951298585 3:20969441-20969463 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
952186330 3:30973552-30973574 GTGGATTCAGCTGAGTGAGTGGG - Intergenic
952297162 3:32071732-32071754 GTGAGTACAGCTGAAGGAGCCGG - Intronic
952343341 3:32463348-32463370 GTGAGTACAGCTGAAGGAGCCGG + Intronic
952654436 3:35767926-35767948 ATGGGTGCACCTGAATGATGGGG - Intronic
952663233 3:35876258-35876280 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
952665121 3:35894964-35894986 ATGGGTACTGCTGATTGATTGGG - Intergenic
952720640 3:36529055-36529077 ATGTATAAATCTGAATGAGTGGG + Intronic
952895825 3:38078206-38078228 GTGAGTACAGCTGAAGGAGCCGG + Intronic
953076895 3:39579733-39579755 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
953177433 3:40564756-40564778 GTGAGTACAGCTGAAGGAGCCGG - Intronic
954894985 3:53967500-53967522 ATGGGTACTGCTGATTGGTTGGG - Intergenic
955027041 3:55178229-55178251 ATGGGTACAAAGGAATGAGTGGG + Intergenic
956548733 3:70436581-70436603 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
956709480 3:72026981-72027003 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
957295458 3:78327572-78327594 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
957317079 3:78585072-78585094 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
958183103 3:90084842-90084864 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
959288123 3:104441846-104441868 ATGAGTACAGCTGAAGGAGCCGG + Intergenic
959972037 3:112419489-112419511 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
960309894 3:116107249-116107271 GTGAGTACAGCTGAAGGAGCCGG + Intronic
960348699 3:116567146-116567168 ATGGGTACAGTAGAATGCTTAGG - Intronic
961164534 3:124754489-124754511 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
961730814 3:128963471-128963493 GTGAGTACAGCTGAAGGAGCCGG - Intronic
961881277 3:130063047-130063069 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
962287076 3:134095264-134095286 GTATGTACAGCTGGATGAGTGGG - Intronic
962523697 3:136219665-136219687 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
962660898 3:137599468-137599490 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
963425450 3:145116761-145116783 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
963663577 3:148155430-148155452 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
963832126 3:150019515-150019537 AGGGGTAGAGATGAATGAGCCGG - Intronic
964984609 3:162724115-162724137 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
965286506 3:166826029-166826051 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
965626090 3:170685262-170685284 GTGAGTACAGCTGAAGGAGCCGG + Intronic
966085690 3:176065320-176065342 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
966104873 3:176323568-176323590 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
966232623 3:177667782-177667804 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
966397882 3:179520638-179520660 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
966820358 3:183919562-183919584 ATGGGTGAATCTGAATGAATTGG + Intergenic
966965293 3:184985634-184985656 CTGGGTCCAGCTGATTGACTCGG + Intronic
967152354 3:186661798-186661820 ACGAGTACAGCTGAAGGAGCCGG - Intronic
967211934 3:187177459-187177481 GTGAGTACAGCTGAAGGAGCCGG + Intronic
967496449 3:190148281-190148303 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
967561607 3:190923891-190923913 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
967643593 3:191897272-191897294 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
967657880 3:192073017-192073039 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
968993609 4:3931152-3931174 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
969003560 4:4001980-4002002 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
969495827 4:7525675-7525697 GTGGGGACAGGTGACTGAGTTGG - Intronic
969653798 4:8484338-8484360 GTGAGTACAGCTGAAGGAGCCGG + Intronic
969810364 4:9642843-9642865 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
970256188 4:14172454-14172476 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
970263987 4:14260916-14260938 TTAGGTACAGCTAAATAAGTAGG - Intergenic
970532963 4:17001445-17001467 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
971122958 4:23723952-23723974 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
972235429 4:37127773-37127795 ATGGGGACCTCAGAATGAGTTGG - Intergenic
973909560 4:55565700-55565722 ATGGGTACTGCTGATTGGTTGGG - Intronic
975864862 4:78715791-78715813 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
975933658 4:79555908-79555930 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
976558833 4:86478572-86478594 GTGAGTACAGCTGAAGGAGCCGG - Intronic
976884334 4:89966692-89966714 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
977010534 4:91627861-91627883 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
977062277 4:92273432-92273454 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
977270715 4:94914629-94914651 GTGGATACAGTTGAATGAGGAGG + Intronic
978031746 4:103945126-103945148 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
978438844 4:108712930-108712952 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
979054391 4:115977588-115977610 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
979146835 4:117255869-117255891 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
979483349 4:121243497-121243519 ATTGCTAATGCTGAATGAGTAGG + Intergenic
979850080 4:125563564-125563586 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
980111684 4:128642797-128642819 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
980185376 4:129454724-129454746 ATGGGTACTTTTAAATGAGTTGG + Intergenic
980472173 4:133265422-133265444 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
980904168 4:138931644-138931666 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
981539947 4:145836526-145836548 GTGAGTACAGCTGAAGGAGCCGG - Intronic
981584360 4:146285183-146285205 AGGGGAACTGCTGAAGGAGTTGG + Intronic
981844030 4:149145953-149145975 ATGGCTAATGCTGAATGAGTGGG + Intergenic
982083727 4:151814379-151814401 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
982180251 4:152743262-152743284 GTGAGTACAGCTGAAGGAGCCGG + Intronic
982299711 4:153866456-153866478 AAGGGTTCAGGTGAATGAGAAGG + Intergenic
982338692 4:154270484-154270506 TTGGGTAAAGCACAATGAGTAGG + Intronic
982496891 4:156105414-156105436 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
983024106 4:162712878-162712900 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
983055708 4:163096848-163096870 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
983345822 4:166524513-166524535 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
983360639 4:166720084-166720106 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
983448285 4:167880101-167880123 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
983452567 4:167926670-167926692 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
983659800 4:170120230-170120252 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
983707928 4:170681478-170681500 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
983805568 4:171987962-171987984 GTGAGTACAGCTGAAGGAGCCGG + Intronic
984098783 4:175463116-175463138 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
984165124 4:176296780-176296802 GTGAGTACAGCTGAAGGAGGCGG + Intergenic
984437525 4:179724435-179724457 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
985389630 4:189481302-189481324 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
985435968 4:189929845-189929867 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
985582573 5:706566-706588 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
986193751 5:5519323-5519345 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
986389100 5:7267363-7267385 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
986663208 5:10077316-10077338 ATGGGTGCACCTGAATGAGTGGG - Intergenic
987282221 5:16423499-16423521 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
987497902 5:18670786-18670808 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
987498848 5:18680588-18680610 CTGTGTACAGGTGAATGGGTAGG + Intergenic
988199359 5:28049633-28049655 GTGGGTACAGCTGAAGGAGCTGG - Intergenic
988285606 5:29212500-29212522 ATGGGTGCTGCTGACTGACTGGG + Intergenic
992051309 5:72943508-72943530 ATGGCTTGAGCAGAATGAGTGGG - Intergenic
992394893 5:76361134-76361156 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
994295371 5:98082847-98082869 ATGAGTATAGCTGAAGGAGCTGG - Intergenic
994532319 5:100986188-100986210 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
994775904 5:104035389-104035411 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
994778727 5:104066130-104066152 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
994784183 5:104134406-104134428 ATGGGTACTGCTGATTGGTTGGG - Intergenic
995296900 5:110533613-110533635 GTGAGTACAGCTGAAGGAGCCGG - Intronic
995899145 5:117048307-117048329 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
996358395 5:122620799-122620821 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
996510127 5:124307568-124307590 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
996723095 5:126648864-126648886 GTGAGTACAGCTGAAGAAGTGGG - Intergenic
996745174 5:126841275-126841297 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
997005840 5:129815190-129815212 ATGGGTACTGCTGATTGGTTGGG + Intergenic
997746626 5:136305090-136305112 GTGAGTACAGCTGAAGGAGCCGG - Intronic
998030560 5:138863833-138863855 ATGGGTACTGCTGATTGATTGGG + Intronic
998693436 5:144613072-144613094 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
998996175 5:147870916-147870938 ATGAGTACAGCTGAAGGAGCCGG + Intronic
1000439977 5:161252484-161252506 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1001272962 5:170329596-170329618 ATGGATGAAGATGAATGAGTTGG - Intergenic
1001331222 5:170763977-170763999 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1001582492 5:172808340-172808362 ATGGGTGCTGCTGACTGGGTGGG + Intergenic
1001615705 5:173041937-173041959 ATGGGTAGTGCTGACTGAGTAGG + Intergenic
1003841625 6:10126525-10126547 ATTGGTACAGCTGTTTGACTTGG - Intronic
1004106486 6:12671138-12671160 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1004283295 6:14298886-14298908 GTGAGTACAGCTGAAGGAGCGGG + Intergenic
1004507769 6:16260923-16260945 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1004698671 6:18058078-18058100 CTGGGTACAGCTGTATCATTAGG - Intergenic
1004768346 6:18756001-18756023 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1004837265 6:19542894-19542916 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1005014428 6:21363439-21363461 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1005937002 6:30530764-30530786 ATGGGTGCTGCTGATTGATTGGG - Intergenic
1006325060 6:33347429-33347451 ATGAGTACAGCTGAAGGAGCCGG - Intergenic
1006498178 6:34439244-34439266 ATTGGTTCAGCTGAAAGAGGTGG - Intergenic
1010071460 6:71750275-71750297 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1011001684 6:82596131-82596153 ATAGTTACAGCTGAAAAAGTTGG - Intergenic
1011367640 6:86600095-86600117 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1012066314 6:94555872-94555894 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1012248400 6:96952959-96952981 ATGGGTGCTGCTGATTGATTGGG - Intronic
1013474090 6:110491610-110491632 ATGGGTGCTGCTGATTGATTGGG + Intergenic
1014396295 6:120928951-120928973 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1014614442 6:123584225-123584247 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1014719124 6:124895819-124895841 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1015108353 6:129563999-129564021 ATGGGTACAACTGATTGTATGGG - Intergenic
1015165466 6:130196307-130196329 GTGAGTACAGCTGAAGGAGCTGG - Intronic
1015266970 6:131299230-131299252 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1015278381 6:131406593-131406615 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1015287823 6:131506273-131506295 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1015323097 6:131897957-131897979 ATGGGTACTGCTGATTGGTTGGG + Intergenic
1015324056 6:131905465-131905487 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1015805296 6:137102344-137102366 ATGAGTAAAGCTGAAGGAGGGGG - Intergenic
1016113919 6:140259382-140259404 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1016249121 6:142019798-142019820 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1016535535 6:145105085-145105107 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1016680450 6:146823370-146823392 ATGGGAACTGCTGATTGATTTGG - Intergenic
1016853501 6:148643580-148643602 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1017389733 6:153925265-153925287 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1017779116 6:157702586-157702608 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1017922592 6:158885122-158885144 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1018084263 6:160288506-160288528 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1018135984 6:160778871-160778893 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1018495170 6:164340670-164340692 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1018521242 6:164654088-164654110 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1019858687 7:3636093-3636115 ATGTATACAGCTTGATGAGTTGG + Intronic
1020316278 7:6907559-6907581 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1021393883 7:20124581-20124603 GTGAGTACAGCTGAAAGAGCCGG - Intergenic
1021430078 7:20549220-20549242 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1021517346 7:21503028-21503050 ATGCGAACAGCTGCATGAGGTGG - Intronic
1021810876 7:24400055-24400077 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1021977677 7:26026127-26026149 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1022709810 7:32839848-32839870 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1022854520 7:34302051-34302073 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1023106474 7:36767895-36767917 ATGTGTACAATTGAGTGAGTGGG - Intergenic
1023537864 7:41232400-41232422 ATGGGTACTGTTGAATGGTTGGG - Intergenic
1023777262 7:43619702-43619724 ATGGGTACCCCTGAATATGTGGG + Exonic
1025100243 7:56128694-56128716 ATTTGTGCAGCTGGATGAGTTGG + Intergenic
1027852178 7:83463442-83463464 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1027954087 7:84857552-84857574 ATGGGTACTGCTGATTGGTTGGG - Intergenic
1028481407 7:91310079-91310101 ATGGGCACAGCTGTGTGACTTGG - Intergenic
1028670731 7:93397711-93397733 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1028690398 7:93643634-93643656 GTGGGTACAGCTGAAGGAGCCGG - Intronic
1029799565 7:102932407-102932429 ATAGATAGAGATGAATGAGTGGG - Intronic
1031004898 7:116459284-116459306 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1031125676 7:117771098-117771120 ATGGGTCCAGCTGAAACAGAGGG + Intronic
1031296875 7:120012867-120012889 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1031364538 7:120887560-120887582 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1031422187 7:121565543-121565565 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1031686071 7:124732809-124732831 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1031776543 7:125913771-125913793 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1033675719 7:143539155-143539177 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1033696115 7:143790289-143790311 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1034355242 7:150446031-150446053 GTGGGGACAGCTGGATGTGTTGG - Intergenic
1034818761 7:154197648-154197670 ATAGATAAAGCTGACTGAGTTGG - Intronic
1035198078 7:157239849-157239871 CTGGGTGCAGCTGCATGAGCTGG + Intronic
1036070662 8:5438363-5438385 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1036281703 8:7406209-7406231 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1036339767 8:7905362-7905384 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1037636312 8:20703824-20703846 ATGGGAACAACTGAGTGGGTAGG - Intergenic
1037826392 8:22163019-22163041 ATGGGTACCACTGGCTGAGTAGG + Intronic
1037991562 8:23324763-23324785 ATGGGTCCAGGCCAATGAGTGGG + Intronic
1040100713 8:43500712-43500734 CTAGGAACAGCTGAATGACTGGG + Intergenic
1040702658 8:50086304-50086326 ATGGGTACAGAGGAAGAAGTTGG + Intronic
1041055337 8:53979899-53979921 ATGGGTGCTGCTGATTGATTGGG - Intronic
1042453789 8:68976951-68976973 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1042707599 8:71678692-71678714 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1043991913 8:86765724-86765746 AAGGGTACTGCTGAATAATTGGG - Intergenic
1044148290 8:88744147-88744169 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1044258394 8:90092145-90092167 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1044573738 8:93746997-93747019 ATGGGTGCAGCTGAATGGTTGGG + Intergenic
1044756280 8:95465306-95465328 ATGGCTACCGCTGAAAGAGGTGG - Intergenic
1044875104 8:96657458-96657480 ACGGAGACAGCTGAATGAATAGG - Intronic
1044919117 8:97149233-97149255 ATGGGTGCAGCTGATTGGTTGGG - Intronic
1044922221 8:97178852-97178874 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1045645006 8:104289714-104289736 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1046386122 8:113511445-113511467 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1046440238 8:114245116-114245138 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1046443475 8:114285765-114285787 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1046559504 8:115818377-115818399 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1047699577 8:127435498-127435520 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1047829319 8:128613846-128613868 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1047873828 8:129113575-129113597 ATGTGTCCAGTTGAATCAGTGGG + Intergenic
1048397381 8:134026970-134026992 ATGGGTGCTGCTGATTGATTGGG - Intergenic
1049223492 8:141438619-141438641 ATGGGTAGAGATGAATGGGTGGG + Intergenic
1049260438 8:141636144-141636166 ATGGGCAAGGCGGAATGAGTAGG + Intergenic
1050117876 9:2279550-2279572 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1050257831 9:3812888-3812910 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1051052858 9:12952123-12952145 GTGGGTACAGCTGAAGTAGCCGG - Intergenic
1051599015 9:18853388-18853410 ATGGGTACAGCTGATTGGTTAGG + Intronic
1051953183 9:22660501-22660523 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1051986581 9:23096510-23096532 ATGGCTACAGCTGAAGCAGCTGG - Intergenic
1052192057 9:25672696-25672718 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1053058285 9:35007473-35007495 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1053480965 9:38415899-38415921 ATGGGTACAGCTGAATGAGTGGG - Intronic
1053783431 9:41633412-41633434 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1054807220 9:69406472-69406494 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1055240174 9:74174538-74174560 ATGGCAACAGCTGATTGAGTGGG + Intergenic
1055626988 9:78184800-78184822 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1055810279 9:80141193-80141215 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1055881961 9:81012788-81012810 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1056044504 9:82702651-82702673 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1057378218 9:94543588-94543610 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1057696773 9:97328717-97328739 AGGGGTCAGGCTGAATGAGTGGG - Intronic
1057812314 9:98267539-98267561 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1057982313 9:99673938-99673960 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1058612655 9:106792334-106792356 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1062179429 9:135183029-135183051 ATGGGTCCAGCAGAAGGTGTGGG + Intergenic
1185750461 X:2606982-2607004 ATGGGTAGAGATAGATGAGTGGG - Intergenic
1185858199 X:3555065-3555087 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1185960462 X:4542414-4542436 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1185991287 X:4895361-4895383 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1186112626 X:6274117-6274139 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1186784306 X:12943608-12943630 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1187086294 X:16046622-16046644 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1188131715 X:26442904-26442926 ATTGGTGCAGGAGAATGAGTGGG - Intergenic
1188419767 X:29979320-29979342 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1188431292 X:30107331-30107353 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1188463129 X:30450837-30450859 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1188552924 X:31381490-31381512 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1189315478 X:40052989-40053011 GTGGTCACAGCTGAATGAGCAGG - Intronic
1189516352 X:41716808-41716830 ATAGGCACAGCAGAACGAGTGGG - Intronic
1191025877 X:55912737-55912759 GTGGATAGGGCTGAATGAGTGGG - Intergenic
1192814670 X:74578148-74578170 ATGGTTACAGATTGATGAGTAGG - Intergenic
1193886149 X:86985577-86985599 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1194293391 X:92102175-92102197 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1194308314 X:92274999-92275021 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1194660943 X:96628020-96628042 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1194873535 X:99161175-99161197 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1195606678 X:106813313-106813335 ATGATTACAGCTTAATGAGCTGG + Intronic
1196220757 X:113110649-113110671 GTGGGTACAACTGAAGGAGCCGG + Intergenic
1196525244 X:116722891-116722913 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1196572723 X:117282924-117282946 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1196773637 X:119319711-119319733 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1197471231 X:126867066-126867088 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1197663096 X:129194791-129194813 ATGGGTGCTGCTGATTGATTGGG + Intergenic
1197933317 X:131715848-131715870 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1198470122 X:136938519-136938541 ATGAGTACAGCTGAGTGCGGTGG - Intergenic
1198598674 X:138262583-138262605 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1198599170 X:138266250-138266272 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1198860840 X:141068253-141068275 ATGAGTACATCTGGATGTGTAGG - Intergenic
1198901852 X:141519133-141519155 ATGAGTACATCTGGATGTGTAGG + Intergenic
1199576704 X:149319437-149319459 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1200532622 Y:4357336-4357358 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1200610909 Y:5326721-5326743 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1201482615 Y:14456179-14456201 ATGGATAAAGCTGAATAACTAGG + Intergenic