ID: 1053480966

View in Genome Browser
Species Human (GRCh38)
Location 9:38415900-38415922
Sequence GATGGGTACAGCTGAATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480966_1053480970 -6 Left 1053480966 9:38415900-38415922 CCACTCATTCAGCTGTACCCATC 0: 1
1: 0
2: 1
3: 13
4: 149
Right 1053480970 9:38415917-38415939 CCCATCTGAGGGCCCTCTGAAGG No data
1053480966_1053480972 -5 Left 1053480966 9:38415900-38415922 CCACTCATTCAGCTGTACCCATC 0: 1
1: 0
2: 1
3: 13
4: 149
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480966_1053480973 -2 Left 1053480966 9:38415900-38415922 CCACTCATTCAGCTGTACCCATC 0: 1
1: 0
2: 1
3: 13
4: 149
Right 1053480973 9:38415921-38415943 TCTGAGGGCCCTCTGAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480966 Original CRISPR GATGGGTACAGCTGAATGAG TGG (reversed) Intronic
900700360 1:4044760-4044782 TATGGGTACAACTGAAAGGGTGG + Intergenic
903626678 1:24735672-24735694 GAGGAGTAAAGCAGAATGAGGGG - Intergenic
904570648 1:31461908-31461930 GTTGGGTACAACAGAATGAGTGG - Intergenic
906560238 1:46751208-46751230 GAAGGGAACAGGTGAAAGAGGGG - Intergenic
907292856 1:53428075-53428097 AGTGAGTACAGCTGAAGGAGCGG - Intergenic
907503341 1:54899795-54899817 AGTGAGTACAGCTGAAGGAGCGG + Intergenic
909604691 1:77496594-77496616 TATGGGAACAGGTGAATGAAAGG + Intronic
912926274 1:113915924-113915946 GAAGGGTAGAGCTAAATGAAGGG - Intergenic
920318753 1:205100777-205100799 GTTGGGGACAGCTGACTTAGAGG - Intronic
920677422 1:208048000-208048022 AATGGGTACAGCTGAGCCAGGGG + Intronic
920680477 1:208068805-208068827 GGAGGGAACAGCTGAATGAAAGG - Intronic
922043358 1:221918924-221918946 GATGGTCACAGGTGATTGAGTGG + Intergenic
1063114250 10:3063162-3063184 CATGGGTGCTGCTGAATGAATGG - Intergenic
1064481127 10:15741856-15741878 GATAAATACAGCAGAATGAGTGG - Intergenic
1066064014 10:31749586-31749608 GATGGGTTCAGCTAAATAAGTGG - Intergenic
1069314911 10:67086093-67086115 GATATGGACAGATGAATGAGTGG + Intronic
1072109440 10:92304774-92304796 GATCGGTAAATCTGAATGAGGGG - Intronic
1073582906 10:104683904-104683926 GATGGTTATAACTCAATGAGAGG - Intronic
1076398188 10:130157113-130157135 GATAGGTACAGATAGATGAGAGG + Intronic
1080069911 11:28070138-28070160 GATGGGTAGACCTGAAACAGTGG + Intronic
1080181270 11:29429249-29429271 AAAGGTAACAGCTGAATGAGGGG - Intergenic
1085920144 11:80944654-80944676 GCTGGGAACAGCTGAATGGGAGG - Intergenic
1086489899 11:87348672-87348694 GTTGGGGACCGCTGAATGAGAGG + Intergenic
1087814172 11:102640627-102640649 AATGGCTACAGCTTAATGAGTGG + Intergenic
1088074810 11:105834381-105834403 CATGGGGACAGATGTATGAGTGG - Intronic
1088836334 11:113580664-113580686 GAAGGGAACATCTGTATGAGAGG + Intergenic
1092496375 12:8999439-8999461 GATAGGTAAAGTTGAATGAGAGG - Intronic
1092910746 12:13142880-13142902 GATGGGCACAGCTGGAGGAAAGG + Intergenic
1095782007 12:46070891-46070913 GGTGGGAAGAACTGAATGAGAGG - Intergenic
1097451882 12:59746661-59746683 GCTGGGTTCAGATGCATGAGAGG - Intronic
1098001889 12:65953313-65953335 GGGGGATACAGATGAATGAGTGG + Intronic
1099311328 12:81028166-81028188 GTTGGGGACAGGTGAATAAGTGG + Intronic
1107541633 13:41394492-41394514 GAGGGGTATAGATGCATGAGGGG - Intergenic
1108632014 13:52293640-52293662 GGTGGGTCCAGGTGGATGAGGGG - Intergenic
1108654684 13:52518954-52518976 GGTGGGTCCAGGTGGATGAGGGG + Intergenic
1115642730 14:35345073-35345095 GATAAATACAGATGAATGAGTGG - Intergenic
1116013978 14:39384541-39384563 AACGTGTACAGCTGAAGGAGGGG + Intronic
1119854727 14:77891034-77891056 GCTGGGTACAGATGAGTGTGTGG + Intronic
1121678128 14:95771027-95771049 GATGAAGAGAGCTGAATGAGAGG + Intergenic
1125936252 15:43638872-43638894 GCTGGGGACAGCTGGGTGAGGGG - Intronic
1130747684 15:86673748-86673770 TATGAGTACAGCTGAATAGGGGG + Intronic
1131265610 15:90913500-90913522 GATGGAGAAAGATGAATGAGAGG + Intronic
1134148149 16:11784231-11784253 AATGGTTCCAGCTGGATGAGGGG + Intronic
1135093400 16:19540425-19540447 GATGGGATCTGTTGAATGAGTGG + Intronic
1136455197 16:30376340-30376362 AATGGGATCAGCTGAATTAGTGG + Intronic
1137997338 16:53233057-53233079 GCTGGGTAGAACTGAATTAGAGG - Intronic
1138456778 16:57125551-57125573 TATGGGAACAGATGAATGTGTGG + Intronic
1138734852 16:59238603-59238625 AATGGGTACTGCTGATTGGGTGG - Intergenic
1141456182 16:84144363-84144385 GATGTGTACAGGTGACTGCGAGG - Intronic
1141795593 16:86271520-86271542 GTTGGGTCCAGCTTAAGGAGGGG - Intergenic
1143001344 17:3797041-3797063 GATGGGCTCAGCTGACTGTGAGG - Intronic
1144210944 17:13014996-13015018 GATGGGTACAGATGGAAGTGTGG + Intronic
1147718113 17:42521650-42521672 GTTGGGTCCAGCTGAATGCCAGG - Exonic
1150717286 17:67582863-67582885 GCCTGGTTCAGCTGAATGAGAGG + Intronic
1156688281 18:39675910-39675932 GATGGTTAGAGGTGAATGAGAGG + Intergenic
1158706147 18:59794168-59794190 GTTGGGTACAGCTCAATAAATGG + Intergenic
1160792886 19:930851-930873 GATGGCTACAGCAGATTCAGCGG + Intronic
1161245439 19:3249260-3249282 GATGGATACAGGGGACTGAGTGG - Intronic
1162837876 19:13333208-13333230 GGTGGGGACAGCTGGAGGAGAGG - Intronic
1163132338 19:15282643-15282665 GAAGGGCACAGCTGAGTCAGTGG - Intronic
1163160287 19:15460185-15460207 GATGGGTAAGGGTGTATGAGAGG - Exonic
1164706496 19:30323983-30324005 GGTGAGTACAGGTGAATAAGGGG - Intronic
1166531669 19:43546683-43546705 GCTGGGTCCAGCTGCCTGAGTGG + Exonic
1168527971 19:57103833-57103855 GATGGTCACAGCTGGGTGAGGGG - Intergenic
925438905 2:3867173-3867195 GATGGGTGCTGCCGAATGATTGG - Intergenic
927420366 2:22924597-22924619 GATGTGGACAGATGAATGAATGG + Intergenic
927706262 2:25298288-25298310 GAGGGGCACAGCCGAGTGAGGGG - Intronic
928917215 2:36484972-36484994 GATTGTTAAAGCTGGATGAGAGG + Intronic
931148690 2:59548184-59548206 GCTGGGGACAACTGAATGACAGG + Intergenic
932806609 2:74789797-74789819 CAGAGGTACAGCTGAGTGAGAGG - Intergenic
933509702 2:83224764-83224786 GATGTGTAGAGCTGAAAGAAAGG + Intergenic
934072807 2:88400662-88400684 AATGGAAACAGATGAATGAGAGG + Intergenic
935146121 2:100396686-100396708 GATGGGGACAGGTGCATGAATGG - Intronic
936981099 2:118266156-118266178 GATGGGTAGGGTTGAAGGAGAGG + Intergenic
937117741 2:119420839-119420861 GATGGGTGCAGGGGAATGAAAGG + Intergenic
937288385 2:120767274-120767296 CAAGGGTACAGCTGAGTGAGAGG + Intronic
938708775 2:133957202-133957224 GATGGCCACAGCTGATTGACTGG - Intergenic
939474769 2:142673511-142673533 GATGGGGATACCTGAAGGAGGGG - Intergenic
941013573 2:160329379-160329401 AATGGTTACAGCTGTAAGAGCGG + Intronic
941169491 2:162119377-162119399 GGTGGGTTCACCTGATTGAGGGG - Intergenic
942066187 2:172274036-172274058 AATGGATACAGCTGTAGGAGGGG + Intergenic
942158988 2:173162311-173162333 GATGGCTTCAGCTGAGTGACTGG + Intronic
944480696 2:200154494-200154516 GGTGGGTACAGAGAAATGAGGGG - Intergenic
946963581 2:225011674-225011696 GTTGGGTGCAGTTGAATGAAAGG + Intronic
948765688 2:240217575-240217597 GGTGGGTGGAGCTGAAAGAGTGG - Intergenic
948765725 2:240217722-240217744 GATGGGTGGAGCTGAAGGGGTGG - Intergenic
1169423471 20:5477934-5477956 GAAGGGAACAGCTGCAGGAGCGG - Intergenic
1169424749 20:5487086-5487108 GAAGGGAACAGCTGCAGGAGGGG - Intergenic
1169459193 20:5779846-5779868 GTTGCTTACAGCTGAATGGGGGG + Intronic
1170750657 20:19141910-19141932 GAAGAGTACAGAAGAATGAGTGG - Intergenic
1171417266 20:24991608-24991630 GTGGGGTACATATGAATGAGAGG - Intronic
1173914971 20:46700609-46700631 GATGGCTGGAGCAGAATGAGGGG - Intergenic
1175200776 20:57275940-57275962 GATGAGTCCAGCTCAAGGAGTGG - Intergenic
1175792256 20:61747027-61747049 GATGGGCACAGCTGAAGGCCTGG - Intronic
1177007842 21:15696195-15696217 GATGGGTACAGCCGCACAAGTGG + Intergenic
1179130183 21:38629161-38629183 GATGGAAACACCTGGATGAGAGG + Intronic
1179566829 21:42254117-42254139 GATGGGGAATGCTGAATGTGAGG + Intronic
1180119043 21:45734330-45734352 GATGGGCACATGTGAGTGAGTGG - Intronic
1183402687 22:37613910-37613932 GATGGGTCCAGCTGCAGGGGTGG + Intronic
1184095654 22:42314885-42314907 GAGGGGAGCGGCTGAATGAGGGG + Intronic
949419151 3:3846667-3846689 GGTGGGTACAGCTCATTTAGTGG - Exonic
950796193 3:15512314-15512336 GCTGGTGACAGCTGAAGGAGAGG - Intronic
951628072 3:24688583-24688605 GATGGATACAGCTAAATGAGGGG + Intergenic
952654437 3:35767927-35767949 CATGGGTGCACCTGAATGATGGG - Intronic
952665122 3:35894965-35894987 AATGGGTACTGCTGATTGATTGG - Intergenic
954707376 3:52488354-52488376 GCTGGGTACAGCTGCGTGTGGGG - Exonic
955003236 3:54946285-54946307 GATGGGTACAGGAGTATAAGAGG - Intronic
955027040 3:55178228-55178250 GATGGGTACAAAGGAATGAGTGG + Intergenic
960555838 3:119029491-119029513 AATGGGTAGAGCTGAATAACTGG + Intronic
960659281 3:120040824-120040846 GATGGCAACAGCTGCCTGAGAGG - Intronic
962772760 3:138628436-138628458 GATGCATACAGATGAATGTGAGG - Intronic
967758217 3:193194604-193194626 TCTGGGTACAGCTGATTGGGAGG + Intergenic
968837009 4:2972459-2972481 ACTGAGGACAGCTGAATGAGGGG + Intronic
969502783 4:7563525-7563547 GATGGTCATGGCTGAATGAGAGG + Intronic
972098089 4:35374498-35374520 CATGGGTGCAGCTAAATTAGAGG - Intergenic
981844029 4:149145952-149145974 TATGGCTAATGCTGAATGAGTGG + Intergenic
984681079 4:182609535-182609557 GAAGGTTACAGCAGAATCAGAGG - Intronic
986126172 5:4884190-4884212 AATGGGTACAACAGAATCAGAGG + Intergenic
986663209 5:10077317-10077339 CATGGGTGCACCTGAATGAGTGG - Intergenic
987452072 5:18097915-18097937 GATGGGTACAGAAGAAGCAGCGG + Intergenic
989140856 5:38200038-38200060 GATGGGTACATCTGACTTTGTGG - Intergenic
990291748 5:54359360-54359382 GATGGGTACAGGGGAAGAAGAGG - Intergenic
990981123 5:61603098-61603120 GTTGGGAACAGCTGCATCAGGGG - Intergenic
994329578 5:98489745-98489767 CATGGGCACTGCTGAATGCGTGG - Intergenic
998030559 5:138863832-138863854 AATGGGTACTGCTGATTGATTGG + Intronic
998189922 5:140014917-140014939 TATGGCTACAGTAGAATGAGCGG - Intronic
1004283294 6:14298885-14298907 AGTGAGTACAGCTGAAGGAGCGG + Intergenic
1010231310 6:73537924-73537946 GAAGGGCACAGCTCAATGTGGGG - Intergenic
1011403570 6:86991382-86991404 AATGGGTAAAACTGAATGAGGGG + Intronic
1015805297 6:137102345-137102367 AATGAGTAAAGCTGAAGGAGGGG - Intergenic
1020465274 7:8471478-8471500 GATGGGGACTGCTGAATCAATGG + Intronic
1022279550 7:28892629-28892651 GATGGGTTCAGGGGAAGGAGAGG + Intergenic
1028691847 7:93661936-93661958 GATGGGTACAGCACACTGATGGG + Intronic
1029389740 7:100267031-100267053 GGTGGGTACAGATGGATCAGGGG - Intronic
1031125675 7:117771097-117771119 CATGGGTCCAGCTGAAACAGAGG + Intronic
1036147377 8:6266785-6266807 GTGGAGCACAGCTGAATGAGTGG + Intergenic
1038697882 8:29822179-29822201 GATGGTTGCAGCTGGATGTGTGG + Intergenic
1039322258 8:36445348-36445370 AATGGGTACTGCTGACTGATTGG + Intergenic
1043915701 8:85920145-85920167 GCTTGGAACAGGTGAATGAGGGG - Intergenic
1044573737 8:93746996-93747018 AATGGGTGCAGCTGAATGGTTGG + Intergenic
1047410980 8:124624471-124624493 GATGGGTACAGGGGAATCACAGG + Intronic
1049223491 8:141438618-141438640 CATGGGTAGAGATGAATGGGTGG + Intergenic
1050035206 9:1428086-1428108 GATGTGTACAGCTGCAGTAGAGG + Intergenic
1050246025 9:3691096-3691118 TAAGGGTACATCTGAATGACAGG + Intergenic
1053480966 9:38415900-38415922 GATGGGTACAGCTGAATGAGTGG - Intronic
1055240173 9:74174537-74174559 CATGGCAACAGCTGATTGAGTGG + Intergenic
1055851774 9:80640426-80640448 AATGGTTACAGCTGGAAGAGAGG - Intergenic
1056600407 9:88042591-88042613 GATGGCAACAGCTGCCTGAGGGG + Intergenic
1056893653 9:90520478-90520500 GATGGGAAGAGAAGAATGAGGGG - Intergenic
1057144413 9:92748641-92748663 GATGGGAAGAGCTGGCTGAGGGG - Intronic
1057275349 9:93673377-93673399 GATGAGCAGAGCTGGATGAGGGG + Intronic
1057696774 9:97328718-97328740 GAGGGGTCAGGCTGAATGAGTGG - Intronic
1061431592 9:130534697-130534719 GATGAGTACATCTGAACAAGTGG + Intergenic
1185750462 X:2606983-2607005 GATGGGTAGAGATAGATGAGTGG - Intergenic
1187290246 X:17946347-17946369 AATGGGTACACCTGAATAACTGG - Intergenic
1189705912 X:43758610-43758632 GATGGCTATAGCAGATTGAGTGG - Intergenic
1191025878 X:55912738-55912760 GGTGGATAGGGCTGAATGAGTGG - Intergenic
1194979908 X:100429630-100429652 GATGGTTTGAGCTGAAAGAGAGG - Intergenic
1195496948 X:105547430-105547452 GATAGTAACAGCTGAATTAGGGG - Intronic
1195718353 X:107840809-107840831 GATGGGCACAGCTGAAGCAGAGG - Exonic
1197386002 X:125802832-125802854 GATGGGTAATGCTGAAGAAGAGG - Intergenic
1199822606 X:151464110-151464132 GATGGCTACTGATGAATCAGAGG + Intergenic
1200404334 Y:2794618-2794640 CATTGGAACAGCTGAATTAGAGG - Intergenic
1201567090 Y:15376516-15376538 GATGTGTACAGCAGAAAGATAGG - Intergenic