ID: 1053480966

View in Genome Browser
Species Human (GRCh38)
Location 9:38415900-38415922
Sequence GATGGGTACAGCTGAATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480966_1053480970 -6 Left 1053480966 9:38415900-38415922 CCACTCATTCAGCTGTACCCATC No data
Right 1053480970 9:38415917-38415939 CCCATCTGAGGGCCCTCTGAAGG No data
1053480966_1053480972 -5 Left 1053480966 9:38415900-38415922 CCACTCATTCAGCTGTACCCATC No data
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480966_1053480973 -2 Left 1053480966 9:38415900-38415922 CCACTCATTCAGCTGTACCCATC No data
Right 1053480973 9:38415921-38415943 TCTGAGGGCCCTCTGAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480966 Original CRISPR GATGGGTACAGCTGAATGAG TGG (reversed) Intronic