ID: 1053480972

View in Genome Browser
Species Human (GRCh38)
Location 9:38415918-38415940
Sequence CCATCTGAGGGCCCTCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053480965_1053480972 -4 Left 1053480965 9:38415899-38415921 CCCACTCATTCAGCTGTACCCAT 0: 1
1: 0
2: 1
3: 21
4: 540
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480963_1053480972 11 Left 1053480963 9:38415884-38415906 CCTCTATCTGATCCACCCACTCA 0: 1
1: 0
2: 2
3: 20
4: 203
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480962_1053480972 12 Left 1053480962 9:38415883-38415905 CCCTCTATCTGATCCACCCACTC 0: 1
1: 0
2: 2
3: 25
4: 220
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480957_1053480972 30 Left 1053480957 9:38415865-38415887 CCCAGGCTGCTTTCCTCCCCCTC 0: 1
1: 0
2: 6
3: 69
4: 587
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480958_1053480972 29 Left 1053480958 9:38415866-38415888 CCAGGCTGCTTTCCTCCCCCTCT 0: 1
1: 0
2: 11
3: 84
4: 822
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480964_1053480972 -1 Left 1053480964 9:38415896-38415918 CCACCCACTCATTCAGCTGTACC 0: 1
1: 0
2: 1
3: 16
4: 180
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480960_1053480972 14 Left 1053480960 9:38415881-38415903 CCCCCTCTATCTGATCCACCCAC 0: 1
1: 0
2: 4
3: 25
4: 278
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480961_1053480972 13 Left 1053480961 9:38415882-38415904 CCCCTCTATCTGATCCACCCACT 0: 1
1: 0
2: 1
3: 12
4: 198
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480959_1053480972 17 Left 1053480959 9:38415878-38415900 CCTCCCCCTCTATCTGATCCACC 0: 1
1: 0
2: 0
3: 21
4: 298
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data
1053480966_1053480972 -5 Left 1053480966 9:38415900-38415922 CCACTCATTCAGCTGTACCCATC 0: 1
1: 0
2: 1
3: 13
4: 149
Right 1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053480972 Original CRISPR CCATCTGAGGGCCCTCTGAA GGG Intronic
No off target data available for this crispr