ID: 1053481608

View in Genome Browser
Species Human (GRCh38)
Location 9:38420414-38420436
Sequence TGACAAACCTTGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053481601_1053481608 29 Left 1053481601 9:38420362-38420384 CCTTCAAGGCTTCTCTCAGGAGC 0: 1
1: 0
2: 1
3: 26
4: 239
Right 1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG No data
1053481604_1053481608 1 Left 1053481604 9:38420390-38420412 CCCAGTGCTAAATAGAGGGACAA 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG No data
1053481605_1053481608 0 Left 1053481605 9:38420391-38420413 CCAGTGCTAAATAGAGGGACAAG 0: 1
1: 0
2: 1
3: 6
4: 88
Right 1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053481608 Original CRISPR TGACAAACCTTGGGAAAAAC AGG Intronic
No off target data available for this crispr