ID: 1053482193

View in Genome Browser
Species Human (GRCh38)
Location 9:38424069-38424091
Sequence GGCACCGTCTGCGGCTCCGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053482193_1053482196 3 Left 1053482193 9:38424069-38424091 CCGTCGGAGCCGCAGACGGTGCC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1053482196 9:38424095-38424117 CTGCGCGCACACGCAGAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
1053482193_1053482198 13 Left 1053482193 9:38424069-38424091 CCGTCGGAGCCGCAGACGGTGCC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1053482198 9:38424105-38424127 ACGCAGAGCCCGGTGCCCTCGGG 0: 1
1: 0
2: 1
3: 23
4: 135
1053482193_1053482197 12 Left 1053482193 9:38424069-38424091 CCGTCGGAGCCGCAGACGGTGCC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1053482197 9:38424104-38424126 CACGCAGAGCCCGGTGCCCTCGG 0: 1
1: 0
2: 0
3: 20
4: 158
1053482193_1053482201 27 Left 1053482193 9:38424069-38424091 CCGTCGGAGCCGCAGACGGTGCC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1053482201 9:38424119-38424141 GCCCTCGGGCGCTGCCCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053482193 Original CRISPR GGCACCGTCTGCGGCTCCGA CGG (reversed) Exonic