ID: 1053482194

View in Genome Browser
Species Human (GRCh38)
Location 9:38424078-38424100
Sequence GCGCAGCGCGGCACCGTCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 57}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053482194_1053482196 -6 Left 1053482194 9:38424078-38424100 CCGCAGACGGTGCCGCGCTGCGC 0: 1
1: 0
2: 1
3: 3
4: 57
Right 1053482196 9:38424095-38424117 CTGCGCGCACACGCAGAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
1053482194_1053482204 23 Left 1053482194 9:38424078-38424100 CCGCAGACGGTGCCGCGCTGCGC 0: 1
1: 0
2: 1
3: 3
4: 57
Right 1053482204 9:38424124-38424146 CGGGCGCTGCCCCAGCGGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 278
1053482194_1053482197 3 Left 1053482194 9:38424078-38424100 CCGCAGACGGTGCCGCGCTGCGC 0: 1
1: 0
2: 1
3: 3
4: 57
Right 1053482197 9:38424104-38424126 CACGCAGAGCCCGGTGCCCTCGG 0: 1
1: 0
2: 0
3: 20
4: 158
1053482194_1053482201 18 Left 1053482194 9:38424078-38424100 CCGCAGACGGTGCCGCGCTGCGC 0: 1
1: 0
2: 1
3: 3
4: 57
Right 1053482201 9:38424119-38424141 GCCCTCGGGCGCTGCCCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 211
1053482194_1053482198 4 Left 1053482194 9:38424078-38424100 CCGCAGACGGTGCCGCGCTGCGC 0: 1
1: 0
2: 1
3: 3
4: 57
Right 1053482198 9:38424105-38424127 ACGCAGAGCCCGGTGCCCTCGGG 0: 1
1: 0
2: 1
3: 23
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053482194 Original CRISPR GCGCAGCGCGGCACCGTCTG CGG (reversed) Exonic