ID: 1053482195

View in Genome Browser
Species Human (GRCh38)
Location 9:38424090-38424112
Sequence CTCTGCGTGTGCGCGCAGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053482195_1053482204 11 Left 1053482195 9:38424090-38424112 CCGCGCTGCGCGCACACGCAGAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1053482204 9:38424124-38424146 CGGGCGCTGCCCCAGCGGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 278
1053482195_1053482198 -8 Left 1053482195 9:38424090-38424112 CCGCGCTGCGCGCACACGCAGAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1053482198 9:38424105-38424127 ACGCAGAGCCCGGTGCCCTCGGG 0: 1
1: 0
2: 1
3: 23
4: 135
1053482195_1053482197 -9 Left 1053482195 9:38424090-38424112 CCGCGCTGCGCGCACACGCAGAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1053482197 9:38424104-38424126 CACGCAGAGCCCGGTGCCCTCGG 0: 1
1: 0
2: 0
3: 20
4: 158
1053482195_1053482201 6 Left 1053482195 9:38424090-38424112 CCGCGCTGCGCGCACACGCAGAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1053482201 9:38424119-38424141 GCCCTCGGGCGCTGCCCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 211
1053482195_1053482210 30 Left 1053482195 9:38424090-38424112 CCGCGCTGCGCGCACACGCAGAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1053482210 9:38424143-38424165 CTGGCTCGCGCATACCAGGCCGG 0: 1
1: 0
2: 0
3: 4
4: 60
1053482195_1053482208 26 Left 1053482195 9:38424090-38424112 CCGCGCTGCGCGCACACGCAGAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1053482208 9:38424139-38424161 CGGCCTGGCTCGCGCATACCAGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053482195 Original CRISPR CTCTGCGTGTGCGCGCAGCG CGG (reversed) Exonic