ID: 1053482196

View in Genome Browser
Species Human (GRCh38)
Location 9:38424095-38424117
Sequence CTGCGCGCACACGCAGAGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053482194_1053482196 -6 Left 1053482194 9:38424078-38424100 CCGCAGACGGTGCCGCGCTGCGC 0: 1
1: 0
2: 1
3: 3
4: 57
Right 1053482196 9:38424095-38424117 CTGCGCGCACACGCAGAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
1053482193_1053482196 3 Left 1053482193 9:38424069-38424091 CCGTCGGAGCCGCAGACGGTGCC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1053482196 9:38424095-38424117 CTGCGCGCACACGCAGAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053482196 Original CRISPR CTGCGCGCACACGCAGAGCC CGG Exonic