ID: 1053482198

View in Genome Browser
Species Human (GRCh38)
Location 9:38424105-38424127
Sequence ACGCAGAGCCCGGTGCCCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053482194_1053482198 4 Left 1053482194 9:38424078-38424100 CCGCAGACGGTGCCGCGCTGCGC 0: 1
1: 0
2: 1
3: 3
4: 57
Right 1053482198 9:38424105-38424127 ACGCAGAGCCCGGTGCCCTCGGG 0: 1
1: 0
2: 1
3: 23
4: 135
1053482193_1053482198 13 Left 1053482193 9:38424069-38424091 CCGTCGGAGCCGCAGACGGTGCC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1053482198 9:38424105-38424127 ACGCAGAGCCCGGTGCCCTCGGG 0: 1
1: 0
2: 1
3: 23
4: 135
1053482195_1053482198 -8 Left 1053482195 9:38424090-38424112 CCGCGCTGCGCGCACACGCAGAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1053482198 9:38424105-38424127 ACGCAGAGCCCGGTGCCCTCGGG 0: 1
1: 0
2: 1
3: 23
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053482198 Original CRISPR ACGCAGAGCCCGGTGCCCTC GGG Exonic