ID: 1053482201

View in Genome Browser
Species Human (GRCh38)
Location 9:38424119-38424141
Sequence GCCCTCGGGCGCTGCCCCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053482193_1053482201 27 Left 1053482193 9:38424069-38424091 CCGTCGGAGCCGCAGACGGTGCC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1053482201 9:38424119-38424141 GCCCTCGGGCGCTGCCCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 211
1053482194_1053482201 18 Left 1053482194 9:38424078-38424100 CCGCAGACGGTGCCGCGCTGCGC 0: 1
1: 0
2: 1
3: 3
4: 57
Right 1053482201 9:38424119-38424141 GCCCTCGGGCGCTGCCCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 211
1053482195_1053482201 6 Left 1053482195 9:38424090-38424112 CCGCGCTGCGCGCACACGCAGAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1053482201 9:38424119-38424141 GCCCTCGGGCGCTGCCCCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053482201 Original CRISPR GCCCTCGGGCGCTGCCCCAG CGG Exonic