ID: 1053485724

View in Genome Browser
Species Human (GRCh38)
Location 9:38454622-38454644
Sequence AAGTGGAAGCAGAATGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053485724_1053485731 24 Left 1053485724 9:38454622-38454644 CCAGCCCCATTCTGCTTCCACTT No data
Right 1053485731 9:38454669-38454691 TCCTGAGTGCTCTTACAGTCTGG No data
1053485724_1053485733 25 Left 1053485724 9:38454622-38454644 CCAGCCCCATTCTGCTTCCACTT No data
Right 1053485733 9:38454670-38454692 CCTGAGTGCTCTTACAGTCTGGG No data
1053485724_1053485734 26 Left 1053485724 9:38454622-38454644 CCAGCCCCATTCTGCTTCCACTT No data
Right 1053485734 9:38454671-38454693 CTGAGTGCTCTTACAGTCTGGGG No data
1053485724_1053485729 -10 Left 1053485724 9:38454622-38454644 CCAGCCCCATTCTGCTTCCACTT No data
Right 1053485729 9:38454635-38454657 GCTTCCACTTCTTGTACTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053485724 Original CRISPR AAGTGGAAGCAGAATGGGGC TGG (reversed) Intergenic
No off target data available for this crispr