ID: 1053488272

View in Genome Browser
Species Human (GRCh38)
Location 9:38478461-38478483
Sequence TGCCGGAGCCACGGAGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 607}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053488263_1053488272 9 Left 1053488263 9:38478429-38478451 CCCTTGCCAGCGGGCTAGGCACG No data
Right 1053488272 9:38478461-38478483 TGCCGGAGCCACGGAGGATGAGG 0: 1
1: 1
2: 1
3: 29
4: 607
1053488256_1053488272 26 Left 1053488256 9:38478412-38478434 CCGGTTTCGCCCACTTCCCCTTG No data
Right 1053488272 9:38478461-38478483 TGCCGGAGCCACGGAGGATGAGG 0: 1
1: 1
2: 1
3: 29
4: 607
1053488260_1053488272 16 Left 1053488260 9:38478422-38478444 CCACTTCCCCTTGCCAGCGGGCT No data
Right 1053488272 9:38478461-38478483 TGCCGGAGCCACGGAGGATGAGG 0: 1
1: 1
2: 1
3: 29
4: 607
1053488264_1053488272 8 Left 1053488264 9:38478430-38478452 CCTTGCCAGCGGGCTAGGCACGG No data
Right 1053488272 9:38478461-38478483 TGCCGGAGCCACGGAGGATGAGG 0: 1
1: 1
2: 1
3: 29
4: 607
1053488267_1053488272 3 Left 1053488267 9:38478435-38478457 CCAGCGGGCTAGGCACGGAGGAG No data
Right 1053488272 9:38478461-38478483 TGCCGGAGCCACGGAGGATGAGG 0: 1
1: 1
2: 1
3: 29
4: 607
1053488259_1053488272 17 Left 1053488259 9:38478421-38478443 CCCACTTCCCCTTGCCAGCGGGC No data
Right 1053488272 9:38478461-38478483 TGCCGGAGCCACGGAGGATGAGG 0: 1
1: 1
2: 1
3: 29
4: 607
1053488262_1053488272 10 Left 1053488262 9:38478428-38478450 CCCCTTGCCAGCGGGCTAGGCAC No data
Right 1053488272 9:38478461-38478483 TGCCGGAGCCACGGAGGATGAGG 0: 1
1: 1
2: 1
3: 29
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053488272 Original CRISPR TGCCGGAGCCACGGAGGATG AGG Intergenic
901063270 1:6483579-6483601 TGCTGGAGCCCAGGAGGTTGAGG + Intronic
901456786 1:9367704-9367726 GGAGGCAGCCACGGAGGATGAGG - Exonic
901507774 1:9696664-9696686 TGCCTGAGCTAGGGAGGTTGAGG + Intronic
902232791 1:15038168-15038190 TGCTTGAGCCAGGGAGGTTGAGG + Intronic
902338249 1:15766189-15766211 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
902365370 1:15969590-15969612 TGCCTGGGCCTCGGAGGGTGGGG + Intronic
902657059 1:17876401-17876423 TGACTGAGCCAAGGAGGTTGAGG - Intergenic
903477875 1:23632652-23632674 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
903639863 1:24851462-24851484 TGACGGAGCCCAGGAGGTTGAGG - Intergenic
903996077 1:27306323-27306345 TGCCGGGGCCTCTGATGATGAGG + Exonic
904068668 1:27775353-27775375 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
906169889 1:43715702-43715724 TGCCTGAGCCTAGGAGGTTGAGG + Intronic
906317312 1:44794755-44794777 TGCCTGAGCCAGGGAGGTCGAGG + Intergenic
907186476 1:52613338-52613360 TGCCTGAGCCTAGGAGGTTGAGG - Intergenic
907775008 1:57505752-57505774 TGCCTGAGCCCAGGAGGCTGAGG - Intronic
908347980 1:63255098-63255120 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
908672166 1:66559866-66559888 TGCTGGAGCCAGGGAGGAGGGGG + Intronic
908948972 1:69536352-69536374 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
908998085 1:70183633-70183655 TGCCTGAGTCAGGGAGGCTGAGG - Intronic
909928181 1:81463029-81463051 TGCCTGAGCCTAGGAGGTTGAGG + Intronic
910532157 1:88250030-88250052 TGCTTGAGCCACGGAGGTGGAGG - Intergenic
911206260 1:95094212-95094234 TGCTTGAGCCACAGAGGTTGAGG - Intergenic
911589183 1:99726788-99726810 TGCCCGAGCCCAGGAGGTTGAGG - Intronic
913538372 1:119795712-119795734 CTCAGGAGCCACAGAGGATGGGG + Intronic
914245910 1:145885765-145885787 GGTCGGGGCCACGGGGGATGGGG + Exonic
915110542 1:153562043-153562065 TGCTGGAGCCCAGGAGGTTGAGG - Intronic
915325792 1:155080638-155080660 AGCCAGAGCCGGGGAGGATGCGG + Intronic
916146414 1:161744119-161744141 TGCAGGAGGCAAGGAGGAAGTGG - Intergenic
916352566 1:163868056-163868078 TATGGGAGCCAAGGAGGATGTGG + Intergenic
916764948 1:167851268-167851290 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
919096737 1:193046113-193046135 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
919627509 1:199926041-199926063 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
919744737 1:201001462-201001484 TGCCTGAGCCCGGGAGGCTGAGG - Intronic
920220600 1:204397102-204397124 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
921342577 1:214148881-214148903 TGCCAGAGTCACGGAGCAAGTGG + Intergenic
922326600 1:224534079-224534101 TGCTTGAGCCTCGGAGGTTGAGG + Intronic
922341370 1:224658247-224658269 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
922447434 1:225709240-225709262 TGCCGGAGCTACTGGAGATGTGG - Intergenic
922525753 1:226301983-226302005 TGCTGGAGCCTGGGAGGTTGAGG + Intronic
922632393 1:227129581-227129603 TGCTTGAGCCCCGGAGGTTGAGG + Intronic
922921901 1:229312451-229312473 TGCTTGAGCCCCGGAGGTTGAGG - Intergenic
923263188 1:232286795-232286817 TGCTTGAGCCAAGGAGGTTGAGG + Intergenic
923475473 1:234327451-234327473 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
923567358 1:235086143-235086165 TGCTGGAGCCCGGGAGGTTGAGG + Intergenic
923575516 1:235155423-235155445 TGCCTGAGCCTGGGAGGTTGAGG - Intronic
923593133 1:235338296-235338318 TACCGGAGCCTGGGAGGTTGAGG + Intronic
923818233 1:237404168-237404190 TGCTGGAGCCTGGGAGGTTGAGG + Intronic
924187091 1:241504523-241504545 TGCCTGAGCCATGGAGGTTGAGG - Intronic
924527212 1:244863527-244863549 TGCCGGAGCCCCGCAGGGGGAGG - Intronic
924681224 1:246236312-246236334 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
924727689 1:246685387-246685409 TGCTGGAGCCCAGGAGGTTGAGG - Intergenic
1063662081 10:8041960-8041982 TGCCGGTGCCAATTAGGATGAGG + Intergenic
1064040300 10:11956902-11956924 TGCTTGAGCCATGGAGGAGGAGG - Intronic
1065014088 10:21445771-21445793 CGCCTGAGCCCAGGAGGATGAGG + Intergenic
1065037081 10:21650265-21650287 TGCTGGAGCCTAGGAGGTTGAGG + Intronic
1065290388 10:24223795-24223817 TGCTTGAGCCGCGGAGGTTGAGG - Intronic
1065353843 10:24820010-24820032 TGCTGGAGCCCTGGAGGCTGAGG + Intergenic
1065730312 10:28704201-28704223 TGCTTGAGCCTGGGAGGATGAGG + Intergenic
1066179133 10:32942766-32942788 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
1066988202 10:42487061-42487083 TGCTGGAGCGACGGAGAACGTGG + Intergenic
1067111419 10:43403906-43403928 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1067818353 10:49501874-49501896 TGCTTGAGCCATGGAGGTTGAGG + Intronic
1068123925 10:52814605-52814627 TGCTGGAGCCAGGGAGGAAGGGG + Intergenic
1068726331 10:60307414-60307436 TGCTTGAGCCCTGGAGGATGAGG - Intronic
1068743102 10:60497219-60497241 TGCTGGAGCCCAGGAGGTTGAGG + Intronic
1069447904 10:68490971-68490993 TGCCTGAGCCTAGGAGGTTGAGG - Intronic
1069775216 10:70923218-70923240 TGCTTGAGCCAGGGAGGTTGAGG - Intergenic
1069999170 10:72363517-72363539 TGCTTGAGCCAAGGAGGTTGAGG - Intergenic
1070040450 10:72772980-72773002 TGCCTGAGCCTGGGAGGTTGAGG - Intronic
1070127720 10:73635463-73635485 TGCCTGAGCCAGGGAGGTGGAGG - Intronic
1070839602 10:79474645-79474667 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
1071224204 10:83509126-83509148 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
1071664185 10:87537851-87537873 TGCCTGAGCCTGGGAGGTTGAGG - Intronic
1071701334 10:87940361-87940383 TGCCAGAGCCTGGGAGGTTGAGG + Intronic
1072270618 10:93772994-93773016 TGCTGGAGCCAGGGAGGCGGAGG + Intronic
1072348794 10:94537776-94537798 TGCCTGAGCCTGGGAGGTTGAGG + Intronic
1073560542 10:104492898-104492920 TGCTTGAGCCAGGGAGGTTGAGG - Intergenic
1074577086 10:114680520-114680542 TGCCAGAGCCACAGAGGATTGGG - Intronic
1075388509 10:122075322-122075344 TGCAGGTGCCATGAAGGATGGGG + Intronic
1075527935 10:123201934-123201956 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
1075889126 10:125930418-125930440 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
1076220133 10:128727276-128727298 TGCCGCAGCCACTGAGGACAGGG - Intergenic
1076723976 10:132404879-132404901 TCCCGGAGCCACAGCGGGTGAGG - Exonic
1077092400 11:785339-785361 TCCCTGAGCCAAGGAGGTTGAGG - Intergenic
1077899712 11:6478654-6478676 TGCAGGAGGGAGGGAGGATGAGG + Intronic
1078026118 11:7697118-7697140 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
1078060379 11:8039291-8039313 TGCCGGAGCCCTGGAGGCTGGGG - Intronic
1078275051 11:9835546-9835568 CGCCTGAGCCAGGGAGGTTGAGG + Intronic
1078582118 11:12546792-12546814 TGCCTGAGCCAGGGAGGAGCTGG + Intergenic
1079194623 11:18314782-18314804 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
1079449385 11:20586339-20586361 TGCCTGAGCCTAGGAGGTTGAGG + Intergenic
1080118783 11:28650400-28650422 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1080556722 11:33423943-33423965 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1080579767 11:33632660-33632682 CGCCTGAGCCAAGGAGGTTGGGG - Intronic
1083670986 11:64299854-64299876 GGCCGGGGCCAGGGAGGAGGCGG - Exonic
1083835681 11:65265562-65265584 TGCTTGAGCCAAGGAGGTTGAGG - Intronic
1083927532 11:65817475-65817497 CGCTGGAGCCCAGGAGGATGAGG + Intergenic
1084017875 11:66397280-66397302 TGCTGGAGCCCAGGAGGTTGAGG - Intergenic
1084202604 11:67571273-67571295 TGCTGGAGCCCAGGAGGTTGAGG - Intergenic
1084266113 11:68005986-68006008 TGCTTGAGCCCAGGAGGATGAGG + Intergenic
1084414916 11:69026331-69026353 GGCCTGAGCCCAGGAGGATGAGG - Intergenic
1084444015 11:69193061-69193083 TGGCGGAGCCAAGGAGAGTGTGG - Intergenic
1084612124 11:70209898-70209920 TGCTTGAGCCCAGGAGGATGAGG + Intergenic
1084991935 11:72934023-72934045 TGCCTGAGCCTGGGAGGTTGAGG + Intronic
1085445512 11:76598291-76598313 TGCAGGAGTCAGGGAGGAAGTGG - Intergenic
1086390084 11:86354566-86354588 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1089040180 11:115440860-115440882 TGCTTGAGCCAAGGAGGTTGAGG - Intronic
1089304950 11:117520844-117520866 TGCTTGAGCCAGGGAGGTTGAGG + Intronic
1090194612 11:124803919-124803941 TGCTTGAGCCCCGGAGGTTGAGG - Intergenic
1091197846 11:133747146-133747168 TCCCAGAGCCGCGGAGGAAGCGG - Intergenic
1091971427 12:4790124-4790146 TGCCTGAGCCTGGGAGGCTGAGG + Intronic
1092196633 12:6553686-6553708 TGCTTGAGCCCAGGAGGATGAGG + Intronic
1092451668 12:8607990-8608012 TGCCTGAGCCTGGGAGGTTGAGG - Intronic
1093118658 12:15242133-15242155 TGCTTGAGCCAAGGAGGTTGAGG - Intronic
1093174377 12:15895777-15895799 TGCTGGAGCCTGGGAGGTTGAGG + Intronic
1093489348 12:19687026-19687048 TGCTTGAGCCACGGAGGTCGAGG + Intronic
1093806614 12:23440850-23440872 TGAAGGTTCCACGGAGGATGTGG - Intergenic
1093925159 12:24902573-24902595 TGGCAGAGTCACGTAGGATGTGG + Intronic
1094563280 12:31576055-31576077 TGCTTGAGCCAGGGAGGTTGAGG + Intronic
1094701487 12:32874822-32874844 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
1095263176 12:40122136-40122158 TGCTGGAGCCGAGGAGGTTGAGG - Intergenic
1095708111 12:45259558-45259580 TGCTGGAGCCACGGAGGGCCTGG + Intronic
1096021610 12:48329894-48329916 TGCCAGAGCCAAGGAGGAAGCGG + Exonic
1096174144 12:49501033-49501055 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
1096462682 12:51831020-51831042 TGCCTGAGCCCCGGAGTTTGAGG - Intergenic
1096637025 12:52966514-52966536 TGCCTGAGCCCCAGAGGTTGAGG + Intergenic
1096642477 12:53005608-53005630 TGCTTGAGCCCCGGAGGTTGAGG + Intergenic
1096701798 12:53388894-53388916 TGCCTGAGCCCGGGAGGTTGAGG + Intronic
1096727750 12:53578698-53578720 TGCTGGAGCCAGGGATGTTGAGG + Intronic
1096734471 12:53641787-53641809 TGCAGGGGCCCCGGAGGCTGAGG + Intronic
1096987145 12:55767463-55767485 TGCTTGAGCCAAGGAGGTTGAGG + Intronic
1097399266 12:59109555-59109577 TGCTTGAGCCAGGGAGGTTGAGG - Intergenic
1097949416 12:65410558-65410580 TGCTGGAGCCTAGGAGGTTGAGG + Intronic
1098549973 12:71752242-71752264 TGCTGGAGCCCAGGAGGTTGAGG + Intergenic
1100789876 12:98118626-98118648 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
1102080825 12:110096768-110096790 TGCTTGAGCCAAGGAGGTTGAGG - Intergenic
1102138552 12:110595704-110595726 TGCTTGAGCCCAGGAGGATGAGG + Intergenic
1102158397 12:110748540-110748562 TGCTTGAGCCCCGGAGGTTGAGG + Intergenic
1102206638 12:111095373-111095395 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1102479542 12:113211979-113212001 TGCTTGAGCCAGGGAGGTTGAGG + Intronic
1102827748 12:115964001-115964023 TGCTTGAGCCTGGGAGGATGAGG + Intronic
1103574711 12:121868970-121868992 CGCTGGAGCCAGGGAGGTTGAGG - Intergenic
1103708094 12:122890413-122890435 TGCCTGAGCCTGGGAGGTTGAGG - Intronic
1103781503 12:123401964-123401986 TGCTGGAGCCCAGGAGGTTGAGG - Intronic
1104414672 12:128588346-128588368 TGCTTGAGCCAGGGAGGTTGAGG + Intronic
1104812257 12:131626483-131626505 TACTGGAGACACTGAGGATGGGG - Intergenic
1104997542 12:132667997-132668019 TGCCGGTGCCTGGGAGGTTGAGG + Intronic
1105040624 12:132957890-132957912 TGCCTGAGCCTGGGAGGTTGAGG + Intergenic
1105211023 13:18257021-18257043 TGCTTGAGCCATGGAGGTTGAGG + Intergenic
1105731377 13:23220364-23220386 TGCCTGAGCCAGGGAGGAGGAGG + Intronic
1105759592 13:23501786-23501808 TGCTTGAGCCCAGGAGGATGAGG + Intergenic
1106622524 13:31384876-31384898 TGCTTGAGCCAAGGAGGTTGAGG + Intergenic
1107107985 13:36667353-36667375 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1107682655 13:42867366-42867388 TGCCTGAGCCTGGGAGGTTGAGG + Intergenic
1107890025 13:44905974-44905996 GGCAGGGGCCACGGAAGATGGGG + Intergenic
1108381802 13:49861685-49861707 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
1108494010 13:51006659-51006681 TGCTGGAGCCTCTGAGGCTGTGG + Intergenic
1109592631 13:64506035-64506057 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1111968887 13:94890161-94890183 TGCTTGAGCCAAGGAGGCTGAGG - Intergenic
1112379178 13:98872488-98872510 TGCTTGAGCCCTGGAGGATGAGG - Intronic
1113376003 13:109765966-109765988 AGTCGGAGCCAGGGTGGATGAGG - Intronic
1113376015 13:109766015-109766037 AGTCGGAGCCAGGGTGGATGAGG - Intronic
1113376038 13:109766113-109766135 AGTCGGAGCCAAGGTGGATGAGG - Intronic
1113376071 13:109766260-109766282 AGTCGGAGCCAGGGTGGATGAGG - Intronic
1113376116 13:109766456-109766478 AGTCGGAGCCAGGGTGGATGAGG - Intronic
1113376150 13:109766603-109766625 AGTCGGAGCCAGGGTGGATGAGG - Intronic
1113376173 13:109766701-109766723 AGTCGGAGCCAGGGTGGATGAGG - Intronic
1113552946 13:111207250-111207272 TGCCTGAGCCCAGGAGGCTGAGG - Intronic
1114644307 14:24245788-24245810 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1115213674 14:30993169-30993191 TGCAGGAGCCTGGGAGGTTGAGG + Intronic
1115562326 14:34594435-34594457 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
1117253120 14:53954559-53954581 TGCTGGTGCAACGGAGGAAGGGG - Intronic
1117453651 14:55876341-55876363 TGAGGGATCCACGAAGGATGGGG + Intergenic
1118185578 14:63534701-63534723 TGCCCGAGCCCAGGAGGCTGAGG - Intronic
1118297089 14:64580215-64580237 TGCTTGAGCCAGGGAGGTTGAGG + Intronic
1118690775 14:68337853-68337875 TGCCTGAGCCAAGGAGGTCGAGG - Intronic
1119367964 14:74111518-74111540 TGCTTGAGCCTAGGAGGATGTGG - Intronic
1119597751 14:75951676-75951698 TGCCTGAGCCCCTGAGGTTGAGG + Intronic
1119843618 14:77811723-77811745 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1120790826 14:88580109-88580131 TGCTGGAGCCCGGGAGGCTGAGG + Intronic
1120790835 14:88580141-88580163 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1120790853 14:88580219-88580241 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1122491999 14:102123882-102123904 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
1122495170 14:102148454-102148476 TGCTGGAGCCTGGGAGGTTGAGG + Intronic
1122972866 14:105159413-105159435 TGGCGGGGCCATGGCGGATGTGG - Intronic
1123426294 15:20173052-20173074 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1123535527 15:21179579-21179601 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1123678098 15:22733127-22733149 TGCCTGAGCCCTGGAGGTTGGGG - Intergenic
1123783618 15:23647620-23647642 TGGCGGAGCCCGGGAGGAAGCGG + Exonic
1123909162 15:24949909-24949931 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
1125725094 15:41864105-41864127 TGCCTGGGCCCCGGAGCATGAGG + Intronic
1125954893 15:43783681-43783703 TGCTTGAGCCAAGGAGGTTGAGG - Intronic
1126664315 15:51062374-51062396 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1127408495 15:58680204-58680226 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
1128161819 15:65427895-65427917 TGCTGGAGCCCAGGAGGTTGAGG - Intergenic
1128544098 15:68555801-68555823 TGGCAGAGCCAGGGAGGAGGGGG + Intergenic
1131472145 15:92706771-92706793 TGTCGGAGGCAGGGAGGAGGTGG - Intronic
1132009440 15:98262813-98262835 TGGCAGAGCCTGGGAGGATGTGG + Intergenic
1132305994 15:100812970-100812992 TGCCACAGGCAAGGAGGATGTGG - Intergenic
1132531917 16:455677-455699 TGCCTGAGCCTGGGAGGTTGAGG - Intronic
1132799953 16:1747111-1747133 GGCCGAGGGCACGGAGGATGTGG - Exonic
1133228528 16:4354998-4355020 TGCCAGAGGCCCAGAGGATGTGG + Exonic
1133264739 16:4576222-4576244 TGCCTGGGCAGCGGAGGATGTGG - Exonic
1135016141 16:18926336-18926358 CGCCGGGGCCCCGGAGGACGAGG + Exonic
1135437208 16:22437102-22437124 CGCCGGGGCCGCGGAGGACGAGG - Intronic
1135575757 16:23584302-23584324 TGCCAGAGCTAGGGAGGATGGGG - Intronic
1136172479 16:28497204-28497226 TGCCAGAGAAACTGAGGATGAGG + Exonic
1136333232 16:29595270-29595292 CGCCGGGGCCCCGGAGGACGAGG + Intergenic
1136510007 16:30731765-30731787 TGCAGGAGCCTGGGAGGTTGAGG + Intronic
1136625775 16:31461439-31461461 TGCCAGAAGCACGGTGGATGGGG - Intronic
1136857953 16:33676445-33676467 TGCCTGAGCCCGGGAGGTTGAGG - Intergenic
1137269360 16:46893474-46893496 TGCTGGAGCCACGGATGCGGAGG + Intronic
1137300266 16:47143026-47143048 TGCTGCGGCCACGGAGGCTGCGG - Intronic
1137353153 16:47732264-47732286 TTCAGGAGCCAAGGCGGATGAGG + Intergenic
1138047320 16:53738922-53738944 TGCTTGAGCCCCGGAGGTTGAGG - Intronic
1138515327 16:57532960-57532982 TCCCAGAGGCAGGGAGGATGTGG - Intronic
1139489836 16:67280200-67280222 AGCCGGGGCCACCCAGGATGAGG + Exonic
1140081698 16:71754153-71754175 TGCCTGAGCCTAGGAGGTTGAGG + Intronic
1140500946 16:75433124-75433146 GGCCGGAGCGGCCGAGGATGAGG + Intronic
1140828909 16:78733369-78733391 TGCTGGAGCCCAGGAGGTTGAGG + Intronic
1141508686 16:84498350-84498372 TGCCCGAGCCCAGGAGGTTGAGG - Intronic
1142121121 16:88387202-88387224 TTCCGCAGGCACGCAGGATGGGG - Intergenic
1142194223 16:88732211-88732233 TGCCTGGGCCACAGAGGGTGGGG - Intronic
1203119523 16_KI270728v1_random:1524920-1524942 TGCCTGAGCCCTGGAGGTTGAGG - Intergenic
1143086988 17:4423540-4423562 TGCTTGAGCCAAGGAGGTTGAGG - Intergenic
1143148260 17:4790176-4790198 TCCCGGAGCCACCGAGGCGGAGG + Exonic
1143616157 17:8051089-8051111 TGCTTGATCCACGGAGGAAGAGG + Intergenic
1144181102 17:12753273-12753295 TCCCTGGGCCCCGGAGGATGAGG - Exonic
1146039913 17:29442124-29442146 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
1146047169 17:29518399-29518421 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1146212859 17:30955803-30955825 TGCCTGAGCCTGGGAGGTTGAGG + Intronic
1147450178 17:40499576-40499598 TACCGGAGCCACGGGCGTTGGGG - Intronic
1147624735 17:41892758-41892780 TGCCTGAGCCTTGGAGGTTGAGG - Intronic
1147626356 17:41902908-41902930 TGCTTGAGCCCCGGAGGTTGAGG - Intronic
1147655202 17:42085982-42086004 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
1147673753 17:42191331-42191353 TGGGGGAGCCAGGAAGGATGTGG - Intronic
1147710329 17:42458893-42458915 TCCTGGAGCCGCGGAGGGTGCGG + Exonic
1147913108 17:43869481-43869503 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
1147932975 17:43994645-43994667 AGGCTGAGCCACGGAGGAGGGGG - Intronic
1148155439 17:45422331-45422353 TGCCTCAGCCAGGGAGGCTGAGG + Intronic
1148493663 17:48039056-48039078 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
1149468285 17:56896583-56896605 TGCTTGAGCCCAGGAGGATGAGG + Intronic
1149632205 17:58135608-58135630 TGCTTGAGCCAAGGAGGTTGAGG + Intergenic
1149904260 17:60510630-60510652 TGCCTGAGCCTGGGAGGTTGAGG + Intronic
1150157049 17:62862451-62862473 TGCTGGAGCCCAGGAGGTTGAGG + Intergenic
1150387127 17:64770977-64770999 TGCCTCAGCCAGGGAGGTTGAGG + Intergenic
1150823709 17:68457047-68457069 TGCGGGGGCCACGGAATATGGGG - Intronic
1151492629 17:74441738-74441760 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1152231429 17:79115794-79115816 TCCCGGAGCCCCTGAGGATGGGG + Intronic
1152549086 17:81020413-81020435 TGCTTGAGCCCCGGAGGTTGAGG + Intergenic
1152652480 17:81501516-81501538 TGCTGGAGTCAGGGAGGTTGAGG + Intergenic
1152959577 18:71145-71167 TGCTGGAGCCCGGGAGGTTGAGG + Intronic
1153710035 18:7789239-7789261 TGCTTGAGCCAAGGAGGTTGAGG + Intronic
1153959973 18:10132229-10132251 GGCCGGAGCCACGCTGGGTGAGG + Intergenic
1154013694 18:10597295-10597317 TGCTTGAGCCCCGGAGGGTGAGG + Intergenic
1154152916 18:11920873-11920895 TGCTTGAGCCCCGGAGGGTGAGG + Intergenic
1154266443 18:12883436-12883458 TGGCGGAGCCGCGGTGGTTGGGG - Intronic
1155077685 18:22374966-22374988 TGCCTGAGCCTGGGAGGCTGAGG + Intergenic
1156871587 18:41951913-41951935 TGCTGGAGCCCAGGAGGTTGAGG + Intergenic
1157458398 18:47860050-47860072 TGCCTGAGCCTGGGAGGTTGAGG + Intronic
1157833473 18:50878710-50878732 TGCCTGAGCCACAGAGGAAGGGG - Intergenic
1158359070 18:56651476-56651498 GGGCGGAACTACGGAGGATGCGG - Exonic
1158717925 18:59897351-59897373 TGCTTGAGCCAAGGAGGAGGAGG - Intergenic
1158750155 18:60249579-60249601 GGCTTGAGCCAGGGAGGATGAGG - Intergenic
1159065613 18:63565101-63565123 TGCCTGAGCCCGGGAGGGTGAGG + Intronic
1159425959 18:68286476-68286498 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
1159957453 18:74529956-74529978 TGCTGGAGCCACGCCGGAGGAGG + Intergenic
1160459242 18:79025253-79025275 TGCCCGAGCCCAGGAGGTTGAGG + Intergenic
1161000122 19:1906453-1906475 TGCTTGAGCCCCGGAGGTTGAGG + Intronic
1161017865 19:1992174-1992196 TGCCTGAGCCCGGGAGGTTGAGG - Intronic
1161028828 19:2048735-2048757 TGCCCGAGCCAGGGTGGGTGGGG - Intronic
1161036593 19:2088385-2088407 TGCTTGAGCCCCGGAGGTTGAGG - Intronic
1161098421 19:2407699-2407721 TGCCTGAGCCTGGGAGGTTGAGG - Intronic
1161311843 19:3599236-3599258 TGCTGGAGCCTGGGAGGTTGAGG - Intronic
1161432438 19:4240854-4240876 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1161497049 19:4592321-4592343 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
1162221557 19:9181536-9181558 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
1162505950 19:11085204-11085226 TGCTTGAGCCAAGGAGGTTGAGG - Intergenic
1162518116 19:11162123-11162145 TGCTTGAGCCCCGGAGGTTGAGG + Intergenic
1162535170 19:11259133-11259155 TGCTGGAGCCCAGGAGGTTGAGG - Intronic
1163070257 19:14834176-14834198 CACCGGAGCCAAGGAGGTTGAGG + Intronic
1163441671 19:17325048-17325070 TGCAGCAGCCAGTGAGGATGTGG + Exonic
1163485033 19:17580471-17580493 TGAGGGAGCCATGGAGGATCTGG - Intronic
1163791567 19:19309398-19309420 TGCTTGAGCCCCGGAGGTTGAGG + Intronic
1163875933 19:19867442-19867464 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
1163948208 19:20560263-20560285 TGCTTGAGCCAGGGAGGTTGAGG + Intronic
1164096212 19:22012027-22012049 TGCCTGAGCCCAGGAGGTTGTGG + Intergenic
1164115719 19:22216849-22216871 TGCCTGAGCCCAGGAGGTTGTGG + Intergenic
1164467124 19:28496857-28496879 TGCTGGAGCCTGGGAGGTTGAGG + Intergenic
1164530036 19:29041626-29041648 TGCCCGAGACAGGGAGGAAGGGG + Intergenic
1165117941 19:33540332-33540354 TGCCTGAGCCCGGGAGGTTGAGG - Intergenic
1165156845 19:33794486-33794508 TACCGCAGCCACCTAGGATGAGG + Intergenic
1165209559 19:34223162-34223184 TGCCTGAGCCTGGGAGGTTGAGG - Intronic
1165431973 19:35778046-35778068 TGCAGGAGCCACAGCAGATGGGG + Intronic
1165441264 19:35829448-35829470 TGCCTGAGCCAGGGAAGTTGAGG - Intronic
1165449005 19:35871629-35871651 TGCCCGAGCCGTGCAGGATGAGG - Exonic
1166314424 19:41981078-41981100 TGCCTGAGCCGGGGAGGTTGGGG - Intronic
1166535372 19:43570699-43570721 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1166858730 19:45796983-45797005 TGCCGGAGCCCAGGAGTTTGAGG + Intronic
1166949450 19:46416698-46416720 TGGGGGCGCCACGGAGGACGAGG + Intergenic
1167199133 19:48051961-48051983 TGCCGGAGCCCAGGAGTTTGAGG - Intronic
1167320402 19:48794332-48794354 TGCCTGAGCCCGGGAGGTTGAGG - Intergenic
1167353174 19:48988415-48988437 TGACTGAGCCAGGGAGGTTGAGG - Intronic
1167489672 19:49784782-49784804 TGCTTGAGCCTGGGAGGATGAGG + Intronic
1168332648 19:55579144-55579166 AGCAGGGGCCACGGAGGAGGAGG - Exonic
925863290 2:8201174-8201196 TTCAGAAGCCAAGGAGGATGAGG + Intergenic
926151516 2:10428179-10428201 TGCTGGAGCCCAGGAGGTTGAGG - Intergenic
927825482 2:26306674-26306696 TGCCCGAGCCAGGGAGGTTGAGG - Intergenic
928425257 2:31172498-31172520 TGCCAGTGCCAAGGAGGGTGAGG - Intergenic
928500012 2:31881409-31881431 TGCCTGAGCCTGGGAGGTTGAGG + Intronic
928550007 2:32361002-32361024 TGCCTGAGCCAAGGAGGCAGAGG - Intronic
929123954 2:38506273-38506295 TGCTTGAGCCAGGGAGGTTGAGG - Intergenic
929350968 2:40954364-40954386 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
929548251 2:42870999-42871021 TGCTTGAGCCCAGGAGGATGAGG - Intergenic
929693681 2:44096243-44096265 TGCCTGAGCCTGGGAGGTTGAGG + Intergenic
930085633 2:47495178-47495200 TGCCAGAGACACTCAGGATGGGG - Intronic
930112808 2:47693494-47693516 TGCTTGAGCCCCGGAGGTTGAGG + Intergenic
930744141 2:54863435-54863457 TGCTTGAGCCCCGGAGGAGGAGG + Intronic
931019425 2:58026800-58026822 TGCTTGAGCCAAGGAGGTTGAGG - Exonic
931238795 2:60434232-60434254 TGCTTGAGCCCAGGAGGATGAGG + Intergenic
931591995 2:63894617-63894639 TGCTTGAGCCACGGAGGTTGAGG + Intronic
932043129 2:68320113-68320135 TGATGGAGCCACGCTGGATGAGG + Intergenic
934086397 2:88513404-88513426 TGCCTGAGCCAGGGAGGTTGAGG + Intergenic
934098173 2:88626905-88626927 CGCGCGAGCCGCGGAGGATGCGG - Intronic
934579841 2:95429091-95429113 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
934599606 2:95647634-95647656 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
935292018 2:101619045-101619067 TGCTGGAGCCAGGGAAGTTGAGG - Intergenic
936458129 2:112691153-112691175 TGCCTGAGCCTGGGAGGTTGAGG - Intergenic
936837386 2:116724354-116724376 TGCCTGAGCCTGGGAGGTTGAGG + Intergenic
937224159 2:120358638-120358660 TGCTGGAGCAACTGAGGCTGAGG + Intergenic
938848011 2:135231702-135231724 TGCTGGAGCCTCGGAGGTTGAGG + Intronic
939909235 2:147960803-147960825 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
939954003 2:148509719-148509741 GGCTGGAGCCAGGGAGCATGAGG + Intronic
940320028 2:152366884-152366906 TGCTTGAGCCTCGGAGGTTGAGG + Intronic
940866907 2:158826302-158826324 TGCCAGAGCCACGGGGGACAAGG + Intronic
941113139 2:161439807-161439829 TGCTTGAGCCAGGGAGGCTGAGG + Intronic
941965589 2:171297246-171297268 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
942278183 2:174337411-174337433 CGCCGGAGTCATGCAGGATGAGG - Exonic
942338960 2:174922605-174922627 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
943405345 2:187476421-187476443 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
944790415 2:203119249-203119271 TGCTTGAGCCCAGGAGGATGAGG - Intronic
945017390 2:205533809-205533831 TGCTTGAGCCCCGGAGGTTGAGG - Intronic
945123743 2:206485962-206485984 AGCCAGAGCTAAGGAGGATGTGG + Intronic
945562505 2:211356028-211356050 TGCTTGAGCCTCGGAGGTTGAGG + Intergenic
946758122 2:222966523-222966545 TGCCTGAGCCTCAGAGGTTGAGG + Intergenic
946842730 2:223834671-223834693 TGCTGGAGCCTAGGAGGTTGAGG + Intronic
947476635 2:230455156-230455178 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
948050896 2:234978615-234978637 TGCCAGAGCCAAACAGGATGTGG + Intronic
948382233 2:237558866-237558888 TGCAGCAGCCACGGGGGCTGGGG + Intergenic
948781897 2:240326705-240326727 TGCTTGAGCCTGGGAGGATGAGG + Intergenic
948951930 2:241258438-241258460 TGCCTGAGCCTAGGAGGTTGAGG + Intronic
1169434499 20:5573657-5573679 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1171048924 20:21837666-21837688 TGGCGGAGGCTCGGAGGGTGGGG + Intergenic
1171989056 20:31681555-31681577 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1172422415 20:34828527-34828549 TGCCTGAGCCTGGGAGGTTGAGG + Intergenic
1172505964 20:35462843-35462865 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
1173018782 20:39249771-39249793 TGCTAGAGCCACAGAGGAGGTGG - Intergenic
1173337229 20:42122627-42122649 GGCCTCAGCCAGGGAGGATGAGG - Intronic
1173987744 20:47275684-47275706 TGCCGGAGCCTGGGAGGTTGAGG - Intronic
1174115155 20:48221815-48221837 TGCCTGAGCCTAGGAGGTTGAGG + Intergenic
1174339001 20:49884428-49884450 TGCCGCAGCCATGGGGGCTGTGG + Intronic
1174406121 20:50304520-50304542 TGGCAGAGCCACGGGGGATGGGG + Intergenic
1174465701 20:50715671-50715693 TGCTTGAGCCAGGGAGGTTGAGG - Intergenic
1174574288 20:51525780-51525802 TGACAGAGCCACAGAGGAAGTGG - Intronic
1174608120 20:51776118-51776140 TGCTTGAGCCAAGGAGGCTGAGG + Intergenic
1174938119 20:54894328-54894350 TGCTTGAGCCAAGGAGGTTGAGG + Intergenic
1175128785 20:56773619-56773641 TGCCTGAGCCAAGGAGGCGGAGG + Intergenic
1176077311 20:63254334-63254356 TGCCCGACCCACGGCGGCTGTGG - Intronic
1176953617 21:15074161-15074183 TGCCTGAGCCCCAGAGGCTGAGG - Intergenic
1177071338 21:16512594-16512616 TGCCTGAGCCAGGGAGGTGGAGG - Intergenic
1178563348 21:33659801-33659823 TGCCTGAGCCTGGGAGGTTGAGG - Intronic
1178852711 21:36226675-36226697 TGCTTGAGCCTGGGAGGATGAGG - Intronic
1178943475 21:36926824-36926846 TGCCTGAGCCAGGGAGGTTGAGG - Intronic
1179819547 21:43928901-43928923 TGCCGGAGCCACCTAGGGTGGGG - Intronic
1181043763 22:20205017-20205039 TGTCGGCGCCACGGAGCAAGCGG + Intergenic
1181090692 22:20470563-20470585 TGCTGGAGCCCAGGAGGTTGAGG + Intronic
1181612728 22:24029466-24029488 TGCCTGAGCCCAGGAGGCTGAGG + Intronic
1182275217 22:29184022-29184044 TGCTTGAGCCAGGGAGGTTGAGG - Intergenic
1182284337 22:29235871-29235893 TGCCTGAGCCAGGGAGGTTGGGG - Intronic
1182588353 22:31359891-31359913 TGCTTGAGCTAAGGAGGATGAGG - Intergenic
1182627530 22:31658935-31658957 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
1182728832 22:32471252-32471274 TGCTGGAGCCTGGGAGGTTGAGG - Intergenic
1183530242 22:38349435-38349457 TGCTTGAGCCTGGGAGGATGAGG - Intronic
1183651118 22:39153548-39153570 TGCCGGAGCGACAGAAGTTGGGG - Intergenic
1183926992 22:41213407-41213429 TGCCTGAGCCCAGGAGGCTGAGG - Intronic
1184237479 22:43191177-43191199 TGCTGGAGCCCTGGAGGTTGAGG + Intergenic
1185375051 22:50478808-50478830 TGGCGCAGCCATGGAGGATATGG - Intergenic
949116620 3:334038-334060 TGCTAGAGCCCAGGAGGATGAGG - Intronic
949793971 3:7825734-7825756 TGCCTGAGCCTGGGAGGTTGAGG - Intergenic
950286284 3:11747680-11747702 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
950365433 3:12480258-12480280 TTCCGGAGCCAGGGAGGAGCTGG - Intergenic
950371829 3:12537313-12537335 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
950498842 3:13351568-13351590 TGCTTGAGCCCCGGAGGTTGAGG - Intronic
951279376 3:20729375-20729397 TGCTGGAGCCCAGGAGGTTGAGG - Intergenic
951894280 3:27596054-27596076 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
952488755 3:33844562-33844584 TGCCTGAGCCCTGGAGGTTGGGG - Intronic
952750748 3:36822903-36822925 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
952812740 3:37419647-37419669 TGCTTGAGCCATGGAGGTTGAGG + Intronic
952874324 3:37930342-37930364 TGCCTGAGCCTGGGAGGCTGAGG - Intronic
952890394 3:38036514-38036536 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
953062251 3:39436915-39436937 TGCTTGAGCCAAGGAGGTTGAGG - Intergenic
953611341 3:44450022-44450044 TGCTTGAGCCCAGGAGGATGAGG - Intronic
953663410 3:44907397-44907419 TGCTTGAGCCAGGGAGGTTGAGG + Intronic
953861929 3:46551882-46551904 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
953923939 3:46971173-46971195 GAGCTGAGCCACGGAGGATGGGG - Intronic
954000163 3:47550209-47550231 TGCTTGAGCCACGGAGGTTGAGG - Intergenic
955162342 3:56476459-56476481 TGCTGGAGCCCAGGAGGTTGGGG + Intergenic
955194750 3:56794940-56794962 TGCTGGAGCCAGGGAGTTTGAGG - Intronic
955206862 3:56903945-56903967 TGCCTGAGCCAAGGAGGTTGAGG - Intronic
955388891 3:58504447-58504469 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
956715335 3:72074902-72074924 TGCCTGAGCCAGGGAGGTTGAGG - Intergenic
956760866 3:72443306-72443328 CGCTTGAGCCACGGAGGTTGAGG + Intronic
956908141 3:73788370-73788392 TGCTTGAGCCAGGGAGGTTGTGG + Intergenic
957242409 3:77675745-77675767 TGCCTGAGCCCGGGAGGTTGAGG - Intergenic
957261143 3:77902758-77902780 TGCCTGAGCCAAGGAGATTGAGG + Intergenic
957970153 3:87373565-87373587 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
959012511 3:101094595-101094617 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
959395908 3:105838164-105838186 TGCTTGAGCCAAGGAGGTTGAGG - Intronic
959443278 3:106406021-106406043 TGCCTGAACCCCGGAGGAGGAGG - Intergenic
960687402 3:120307835-120307857 TGCCCTGGTCACGGAGGATGAGG - Intergenic
960805873 3:121583526-121583548 TGCCTGAGCCTGGGAGGTTGAGG - Intronic
960935920 3:122902498-122902520 TGCCTGAGCCCTGGAGGCTGAGG + Intergenic
961071058 3:123927331-123927353 TGCATGAGCCAGGGAGGTTGAGG + Intronic
961148372 3:124614652-124614674 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
961223024 3:125214540-125214562 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
962393755 3:134996275-134996297 TGCCCAAGCCTGGGAGGATGAGG - Intronic
962537857 3:136347012-136347034 TGCTTGAGCCAGGGAGGTTGAGG + Intronic
963267646 3:143254954-143254976 TGCAGGAGCCACGGATGAAAGGG + Intergenic
964310386 3:155385828-155385850 TGCTTGAGCCCAGGAGGATGAGG + Intronic
964990843 3:162809846-162809868 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
965771842 3:172189715-172189737 TGCCTGAGCCTGGGAGGTTGAGG + Intronic
966327302 3:178771563-178771585 TGCTGGAGCCCAGGAGGTTGAGG - Intronic
966578889 3:181536920-181536942 TGCCTGAGCCTGGGAGGCTGAGG - Intergenic
966810329 3:183838103-183838125 TGCCTGAGCCTAGGAGGGTGAGG - Intronic
966884077 3:184365585-184365607 TGCCTGAGCCAGGGAGGTTGAGG + Intronic
968168067 3:196484735-196484757 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
968341119 3:197956711-197956733 TGCCTGAGCCGAGGAGGTTGAGG - Intronic
968620264 4:1600770-1600792 TGCCTGAGCCGGGGAGGCTGAGG - Intergenic
968833058 4:2943093-2943115 TCCCGGAGGCAGGGAGCATGTGG + Intronic
969220625 4:5756326-5756348 TGTCAGAGCCACCGAGGCTGTGG + Exonic
970652104 4:18190260-18190282 TTCCGGAGCCACGCAGCCTGGGG + Intergenic
970712075 4:18875780-18875802 TGCCTGAGGCAGGGAGGGTGAGG + Intergenic
970910486 4:21269487-21269509 TGCTGGAGCCCAGGAGGTTGAGG - Intronic
972616584 4:40704276-40704298 TGCTTGAGCCGTGGAGGATGAGG - Intergenic
973772633 4:54220684-54220706 TGCAGGAGCCCAGGAGGTTGAGG + Intronic
974950935 4:68582421-68582443 TGCAGGGGCCACGGTGGAAGTGG + Intronic
975450048 4:74514554-74514576 TGCTTGAGCCAAGGAGGTTGTGG + Intergenic
975931839 4:79533844-79533866 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
976720083 4:88160763-88160785 TGCTGGAGCCAGGGAGGCAGAGG + Intronic
977929226 4:102733435-102733457 TGCTTGAGCCCCGGAGGTTGAGG - Intronic
979222031 4:118238043-118238065 TGCCTGAGCCTGGGAGGTTGGGG + Intronic
979626728 4:122853212-122853234 TGCTGGAGCCAGGGAAGTTGAGG + Intronic
981419485 4:144532872-144532894 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
983526171 4:168762387-168762409 TGCCTGAGCCTGGGAGGTTGAGG + Intronic
985503375 5:263021-263043 TGCTGGAGCCCCGGAGGTGGAGG - Intergenic
985691113 5:1313120-1313142 TGCCGTGGCCACGGACGGTGAGG - Intergenic
987325902 5:16811631-16811653 TGCCTGAGCCGGGGAGGTTGAGG - Intronic
987348031 5:16996291-16996313 TGCCTGAGCCAAGGAGTTTGAGG - Intergenic
988464353 5:31474444-31474466 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
988506538 5:31828577-31828599 TGCTGGAGCCCAGGAGGTTGAGG - Intronic
989022870 5:37030836-37030858 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
989362662 5:40621303-40621325 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
989583031 5:43051296-43051318 TGCTTGAGCCAAGGAGGTTGAGG + Intergenic
989973321 5:50551400-50551422 TGCTTGAGCCCAGGAGGATGAGG - Intergenic
991687160 5:69191967-69191989 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
991699404 5:69303101-69303123 TGCTGGAGCCCAGGAGGTTGAGG - Intronic
992032846 5:72740560-72740582 TGCCGGAGCCTCGGGGGAGGAGG - Intergenic
992200043 5:74374248-74374270 GGCCTGAGCCACGGTGGAAGTGG + Intergenic
992818439 5:80469184-80469206 TGCCTGAGCCTTGGAGGTTGAGG - Intronic
993719611 5:91309562-91309584 TGCCTGAGCCTCAGAGGTTGAGG - Intergenic
995419207 5:111944389-111944411 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
996706461 5:126503088-126503110 TGCTTGAGCCAAGGAGGTTGAGG + Intergenic
997502006 5:134382688-134382710 TGCTGGAGCCTGGGAGGTTGAGG + Intronic
998087693 5:139340182-139340204 TGCTTGAGCCAGGGAGGTTGCGG + Intergenic
999006577 5:147986770-147986792 TGCCAGAGCCAAGGAGGTTGAGG - Intergenic
999361996 5:150993071-150993093 TGCCGGAGCCACCCAGAAAGGGG + Intergenic
999460805 5:151756554-151756576 TGCTGGAGCCTGGGAGGTTGAGG - Intronic
1000326252 5:160174851-160174873 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
1000332324 5:160215602-160215624 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1002118837 5:176985686-176985708 TGTTTGAGCCAAGGAGGATGAGG - Intronic
1003253856 6:4457402-4457424 TGCCAGAGCCACAGAGGATGAGG + Intergenic
1003285750 6:4732576-4732598 TGCTGGAGCCTGGGAGGTTGAGG + Intronic
1003323720 6:5076026-5076048 TGCCTGAGCCCAGGAGAATGAGG - Intergenic
1003624150 6:7727259-7727281 TGCCGGAGCGCCGGGGGCTGCGG - Exonic
1004568402 6:16821264-16821286 TGCTGGAGCCTAGGAGGTTGAGG + Intergenic
1004714508 6:18204388-18204410 TGCTGGAGCCCCGGAAGTTGAGG + Intronic
1004789121 6:19004774-19004796 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1005204845 6:23390749-23390771 TGCCTGAGCCCAGGAGGCTGAGG + Intergenic
1006015305 6:31076117-31076139 TGCCTGAGCCTGGGAGGCTGAGG - Intergenic
1006307088 6:33229506-33229528 TGCCTGAGCCTGGGAGGTTGAGG + Intergenic
1006310821 6:33257929-33257951 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1006538594 6:34720896-34720918 TGCTGGAGCCGGGGAGGTTGAGG + Intergenic
1006764254 6:36490749-36490771 TGCTTGAGCCCAGGAGGATGAGG + Exonic
1007069666 6:39027149-39027171 TGCTTGAGCCCCGGAGGTTGAGG + Intronic
1007128886 6:39450719-39450741 TGCCTGAGCCCGGGAGGTTGAGG + Intronic
1007525107 6:42485344-42485366 TGCCTGAGCCGGGGAGGTTGAGG - Intergenic
1007652134 6:43429514-43429536 TGCTGGAGCCCAGGAGGTTGAGG - Intronic
1007912097 6:45525906-45525928 TGCTTGAGCCAGGGAGGCTGAGG + Intronic
1011572422 6:88753418-88753440 TGCTGGAGCCTGGGAGGTTGAGG + Intronic
1011718983 6:90135628-90135650 TGCTGGAGCCCAGGAGGTTGAGG + Intronic
1012280034 6:97317148-97317170 TGCCAGAGCCAAAGAGAATGAGG - Intergenic
1013127163 6:107195396-107195418 TGCCTGAGCCTGGGAGGTTGAGG + Intronic
1013569529 6:111407850-111407872 TGCATGAACCCCGGAGGATGAGG + Intronic
1014507515 6:122278250-122278272 TGCCTGAGCCCAGGAGTATGAGG - Intergenic
1015472472 6:133621275-133621297 TGCTTGAGCCAAGGAGGTTGAGG - Intergenic
1015651284 6:135463833-135463855 TGCTGGAGCCTGGGAGGTTGAGG - Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1017160439 6:151360699-151360721 TGCTTGAGCCAAGGAGGTTGAGG - Intergenic
1017163353 6:151386448-151386470 TGCTTGAGCCAGGGAGGCTGAGG + Intronic
1017275596 6:152564398-152564420 TGCTGGAGCCCAGGAGGTTGAGG - Intronic
1018466030 6:164046079-164046101 TGCTGGAGCCTAGGAGGTTGAGG - Intergenic
1018812719 6:167309007-167309029 AGCAGGAGCCAGGGAGGAAGGGG + Intronic
1019103305 6:169649595-169649617 TGTGGGAGCCCCGGGGGATGAGG - Intronic
1019611813 7:1940549-1940571 TCGAGGAGCCAGGGAGGATGTGG + Intronic
1019666981 7:2256900-2256922 TGACGAAGGCGCGGAGGATGTGG + Exonic
1019825566 7:3281463-3281485 TGCCTGAGCCTAGGAGGTTGAGG + Intergenic
1020813884 7:12880454-12880476 TGCTTGAGCCCAGGAGGATGAGG - Intergenic
1020963726 7:14839483-14839505 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
1021182840 7:17528491-17528513 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
1021201641 7:17734358-17734380 TAGCTGAGCCAGGGAGGATGGGG - Intergenic
1021993016 7:26154632-26154654 TGCTGGAGCCGGGGAGGTTGAGG - Intronic
1022099155 7:27158790-27158812 TGCCCCGGCCAAGGAGGATGCGG + Intergenic
1023601657 7:41886938-41886960 AGCCGGAGCCAGGGAAAATGGGG - Intergenic
1023992810 7:45139656-45139678 TGCTTGAGCCCAGGAGGATGAGG - Intergenic
1024163646 7:46707161-46707183 TGCTTGAACCAGGGAGGATGAGG + Intronic
1024189937 7:46995709-46995731 TGCTGGAGCCCAGGAGGTTGAGG + Intergenic
1025789249 7:64672438-64672460 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
1025926023 7:65961230-65961252 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
1025982209 7:66415818-66415840 TGCCTGAGCCCCGGAGGTTGAGG - Intronic
1026040151 7:66861473-66861495 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1026079220 7:67202478-67202500 TGCTGGAGCCTGGGAGGTTGAGG - Intronic
1026252946 7:68686700-68686722 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
1026353787 7:69540014-69540036 TGCTGGAGCCCAGGAGGTTGAGG - Intergenic
1026432389 7:70360209-70360231 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
1026628363 7:72016518-72016540 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
1027206258 7:76102125-76102147 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
1027368419 7:77482646-77482668 TGCTGGAGCCTGGGAGGTTGAGG - Intergenic
1027383392 7:77635343-77635365 TGCCTGAGCCTGGGAGGTTGAGG + Intronic
1027829829 7:83162999-83163021 ATCCGGAGCGACGCAGGATGGGG - Intergenic
1028026530 7:85849039-85849061 TGCTTGAGCCAGGGAGGTTGAGG - Intergenic
1028519744 7:91716755-91716777 TGCCTGAGCCTGGGAGGTTGAGG + Intronic
1028557624 7:92140408-92140430 TGCCTGAGCCCCAGAGGTTGAGG + Intronic
1029142494 7:98421442-98421464 TGCTTGAGCCCAGGAGGATGAGG - Intergenic
1029201796 7:98844076-98844098 TGCTTGAGCCAGGGAGGCTGGGG + Intergenic
1029248252 7:99218081-99218103 TGCCTGAGCCAGGGAGTTTGAGG - Intergenic
1029258135 7:99283335-99283357 TGCTTGAGCCAGGGAGGTTGAGG - Intergenic
1029480214 7:100807723-100807745 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
1029533844 7:101143982-101144004 TGCCTGAGCCAAGGAGGTCGAGG + Intergenic
1029623279 7:101703337-101703359 TGCCTGAGCCTGGGAGGTTGAGG - Intergenic
1030025957 7:105324801-105324823 TGCTTGAGCCACGGAGGCGGAGG + Intronic
1030101060 7:105945777-105945799 TCCAGAAGCCAGGGAGGATGTGG - Intronic
1030575618 7:111282665-111282687 TGCCTGAGCCTGGGAGGTTGAGG - Intronic
1032581282 7:133105600-133105622 TGCCTGAGCCCTGGAGGAGGAGG + Intergenic
1032728168 7:134611561-134611583 TGGCTGAGCCAGGGAGGTTGAGG - Intergenic
1034244171 7:149632054-149632076 TACAGGAGCCATGGAGCATGTGG + Intergenic
1034413403 7:150952926-150952948 TGCCGGGGCCAAGCAGAATGAGG + Intronic
1034684381 7:152957137-152957159 TGCTTGAGCCTCGGAGGTTGAGG + Intergenic
1035449732 7:158968895-158968917 TGCCTGAGCCTGGGAGGTTGAGG + Intergenic
1036560209 8:9895449-9895471 CGCTGGAGCCCCAGAGGATGAGG - Intergenic
1036916321 8:12807270-12807292 TGCCTGAGCCCAGGAGGCTGAGG + Intergenic
1038025907 8:23590579-23590601 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1038504515 8:28073084-28073106 TGCTTGAGCCACGGAGGTTGAGG - Intronic
1038850993 8:31276168-31276190 AGCCGGCTCCAGGGAGGATGAGG + Intergenic
1039353947 8:36794843-36794865 TGCCTGAGCCCAGGAGGCTGAGG + Intronic
1039486534 8:37914575-37914597 TGCTTGAGTCCCGGAGGATGAGG - Intergenic
1039950143 8:42164525-42164547 TGCCGAAGACACTGAGGAAGAGG + Intronic
1040110332 8:43564369-43564391 TGCCGGACCCAGGGAGGGGGTGG - Intergenic
1040356925 8:46627653-46627675 TACCTGAGCCAAGGAGGTTGAGG - Intergenic
1040881279 8:52207406-52207428 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1041315326 8:56555384-56555406 TGCAGGAGCCTGGGAGTATGGGG + Intergenic
1042100002 8:65265490-65265512 TGCTGGAGCCTGGGAGGTTGAGG - Intergenic
1042207752 8:66346058-66346080 TGCTTGAGCCAGGGAGGTTGAGG - Intergenic
1042600840 8:70498149-70498171 TGCTTGAGCCAGGGAGGTTGAGG - Intergenic
1042883716 8:73523961-73523983 TGCCTGAGCCCAGGAGGCTGAGG + Intronic
1044307980 8:90659588-90659610 TGCTTGAGCCTGGGAGGATGAGG - Intronic
1044662110 8:94601599-94601621 TGCCTGAGCCCCGGAGGCAGAGG - Intergenic
1045056782 8:98375169-98375191 TGCCTGAGCCCAGGAGGTTGAGG + Intergenic
1045194205 8:99913604-99913626 AGCCTGAGCCAAGGAGGTTGAGG - Intergenic
1045663390 8:104461207-104461229 TGCTTGAGCCCAGGAGGATGAGG + Intronic
1045667479 8:104505099-104505121 TACCGGAGCCCAGGAGGTTGAGG - Intronic
1046506562 8:115145233-115145255 TGCCTGAGCCAAGGAGTTTGAGG + Intergenic
1046974167 8:120254906-120254928 TGCTGGAGCCCAGGAGGTTGAGG + Intronic
1047585869 8:126271617-126271639 TGCTGGAGCCCAGGAGGTTGAGG + Intergenic
1047982469 8:130197343-130197365 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1048442874 8:134472756-134472778 TGCAGGAGCCCCAGAGGCTGGGG - Intergenic
1049570132 8:143365911-143365933 TGCCTGAGCCTAGGAGGTTGAGG + Intergenic
1049734643 8:144198499-144198521 TGCCTGAGCCCGGGAGGTTGAGG - Intronic
1050611057 9:7354137-7354159 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
1052976678 9:34416090-34416112 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1053488272 9:38478461-38478483 TGCCGGAGCCACGGAGGATGAGG + Intergenic
1054904306 9:70401261-70401283 TGCTTGAGCCAAGGAGCATGAGG + Intronic
1055316347 9:75038226-75038248 TGCCGGGGCCTGGGAGGTTGAGG - Intergenic
1055452963 9:76447321-76447343 TGCCTGAGCCCGGGAGGTTGAGG - Intronic
1056373575 9:85984243-85984265 TGCCTGAGCCCAGGAGGTTGAGG + Intronic
1056900259 9:90592538-90592560 TGCTTGAGCCAGGGAGGTTGAGG - Intergenic
1057330192 9:94107035-94107057 TGCCGGAGCCCAGGAGGCAGAGG - Intronic
1057468932 9:95340479-95340501 TGCTGGAGCCCAGGAGGCTGAGG + Intergenic
1057668619 9:97067736-97067758 TGCCGGAGCCACGGAAGATGAGG + Intergenic
1057690890 9:97283847-97283869 TGCCTGAGCCTGGGAGGTTGAGG - Intergenic
1058696361 9:107562510-107562532 TGCTGGAGCCCAGGAGGCTGAGG - Intergenic
1058994519 9:110286551-110286573 TGCTTGAGCCAGGGAGGCTGAGG + Intergenic
1059291618 9:113230305-113230327 AGCCTGAGCCAGGGAGGTTGAGG - Intronic
1059881929 9:118700652-118700674 TGCCTGAGCCCTGGAGGTTGAGG - Intergenic
1060199175 9:121642162-121642184 TGCTTGAGCCAGGGAGGTTGAGG - Intronic
1060412202 9:123407187-123407209 AGCTGGAGCCTCGGAGGCTGGGG + Intronic
1060943534 9:127556991-127557013 TGCCGGAGCCCGGGAGGTTGAGG + Intronic
1061093051 9:128437539-128437561 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
1061211673 9:129197232-129197254 TGCCTGAGCCGGGGAGGACGAGG - Intergenic
1061423679 9:130486068-130486090 TGCTGGAGCCCAGGAGGTTGAGG - Intronic
1061522087 9:131124709-131124731 TGCCTGAGCCCAGGAGGTTGAGG - Intergenic
1061584198 9:131555590-131555612 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
1061765562 9:132878926-132878948 TGTCGGTGCCCCGGAGGGTGGGG - Exonic
1061978510 9:134086181-134086203 TGCTGGAGCCTGGGAGGGTGAGG - Intergenic
1062064871 9:134521379-134521401 TGCCCTACCCAAGGAGGATGGGG + Intergenic
1062496150 9:136832713-136832735 TGCCTGAGCCCCGGAGTTTGAGG - Intronic
1062543917 9:137053469-137053491 TGCCGCCGCCCCGGAGGGTGCGG - Intronic
1062688989 9:137831935-137831957 TGCAGCAGCCACGTAGGAGGCGG - Intronic
1185821415 X:3208460-3208482 TGCTGGAGCCCGGGAGGTTGCGG + Intergenic
1186000171 X:5000482-5000504 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
1187173484 X:16872905-16872927 TGCCCGAGCCCAGGAGGTTGAGG - Intergenic
1187477704 X:19626649-19626671 TGCCTGAGCCCAGGAGGTTGAGG - Intronic
1187664673 X:21592495-21592517 TGCTTGAGCCAGGGAGGTTGAGG + Intronic
1188502086 X:30838179-30838201 TGCTGGAGCCCAGGAGGTTGAGG - Intronic
1188772720 X:34174331-34174353 TGCTTGAGCCAGGGAGGTTGAGG - Intergenic
1189044136 X:37572498-37572520 TGCCCGAGCCACGGAGTCCGGGG - Intronic
1189508518 X:41637725-41637747 TGCCTGAGCCAGGGAGGTCGAGG - Intronic
1190073420 X:47297655-47297677 CGCCTGAGCCAGGGAGGTTGAGG + Intergenic
1190090809 X:47435661-47435683 TGCTGGAGCCCAGGAGGTTGAGG - Intergenic
1190239735 X:48648177-48648199 TGCCTGAGCCAAGGAGGTCGAGG + Intergenic
1191600665 X:63001603-63001625 TGCTGCAGCCACTGTGGATGAGG + Intergenic
1192506412 X:71686927-71686949 TGCCTGAGCCCAGGAGGAAGAGG + Intergenic
1192520285 X:71794620-71794642 TGCCTGAGCCCAGGAGGAAGAGG - Intergenic
1192525171 X:71836739-71836761 TGCCAGAGCCCAGGAGGAAGAGG + Intergenic
1193202173 X:78704442-78704464 TGCTTGAGCCAGGGAGGTTGAGG + Intergenic
1196751715 X:119124078-119124100 TGCCTGAGCCTGGGAGGTTGAGG - Intronic
1198109397 X:133489287-133489309 GGCCTGAGCCAGGGAGGTTGAGG + Intergenic
1198257664 X:134938645-134938667 TGCTTGAGCCTAGGAGGATGAGG + Intergenic
1198464907 X:136896392-136896414 TGCTTGAGCCAAGGAGGTTGAGG + Intergenic
1199320461 X:146431964-146431986 CGCCGGAGCCAAGGAGGTCGAGG + Intergenic