ID: 1053496648

View in Genome Browser
Species Human (GRCh38)
Location 9:38553055-38553077
Sequence TGCAGGGTTTAGTACCTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053496648_1053496654 6 Left 1053496648 9:38553055-38553077 CCGCCAAGGTACTAAACCCTGCA 0: 1
1: 1
2: 0
3: 16
4: 159
Right 1053496654 9:38553084-38553106 CAGGTGCACCGCCCTAGTAGAGG No data
1053496648_1053496658 18 Left 1053496648 9:38553055-38553077 CCGCCAAGGTACTAAACCCTGCA 0: 1
1: 1
2: 0
3: 16
4: 159
Right 1053496658 9:38553096-38553118 CCTAGTAGAGGTTTTCCATGAGG 0: 28
1: 364
2: 1733
3: 1837
4: 1327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053496648 Original CRISPR TGCAGGGTTTAGTACCTTGG CGG (reversed) Intronic
901294359 1:8148926-8148948 TGCGGGGCTTAATACCTAGGTGG + Intergenic
904558952 1:31384055-31384077 TGCAGGGCTGAGTGCCTTGGAGG + Intergenic
904902854 1:33870979-33871001 GGCAGGGTTCAGTTCCTTGCAGG - Intronic
905963471 1:42066167-42066189 TGCTGGGCTTAATACCTAGGTGG + Intergenic
906855420 1:49298829-49298851 TAGAAGGTTTAGAACCTTGGAGG - Intronic
913424423 1:118711503-118711525 TGCAGGCTTTAGTACCTCTCAGG - Intergenic
913485430 1:119328991-119329013 TGGAGGGCTCAGTACCTTGCTGG + Intergenic
914313550 1:146487848-146487870 TGCTGGGATTAGTACCTGGGTGG + Intergenic
914500798 1:148245533-148245555 TGCTGGGATTAGTACCTGGGTGG - Intergenic
918724288 1:187897711-187897733 TGAAGGGCTAAGTACCTGGGGGG - Intergenic
922377908 1:224987998-224988020 TGCTGGGCTTAATACCTAGGTGG - Intronic
923852020 1:237806423-237806445 TGCAGGGATTAGTAGTTTGAGGG + Intronic
924580195 1:245316852-245316874 TGCAGGTTTTTGTCCCTTGAAGG - Intronic
1063231615 10:4071075-4071097 TGCATGGCTTAGTACATAGGTGG - Intergenic
1063731166 10:8698830-8698852 TGCTGGGCTTAATACCTAGGTGG - Intergenic
1063830938 10:9952075-9952097 TGGAGGTTTTAGCTCCTTGGAGG - Intergenic
1063830955 10:9952222-9952244 TGGAGGCTTTAGCTCCTTGGAGG + Intergenic
1063984819 10:11491230-11491252 TGCAGGGTATTGTACCTTGCTGG - Intronic
1064341764 10:14492239-14492261 GGCAGGATTTAGTTCCTTGTGGG - Intergenic
1065948017 10:30625047-30625069 GGCAGAGTTCAGTTCCTTGGGGG - Intronic
1069341185 10:67410402-67410424 TGCTGGGCTTAATACCTGGGTGG + Intronic
1070681558 10:78452695-78452717 TCCTGGGTCTAGCACCTTGGTGG - Intergenic
1074557955 10:114509293-114509315 ACCAGGGTCCAGTACCTTGGAGG - Intronic
1076610089 10:131720075-131720097 TGCTGGGCTTAATACCTGGGTGG - Intergenic
1077730987 11:4729574-4729596 TGCAAGGTTCAGCTCCTTGGAGG + Intronic
1078278263 11:9872344-9872366 TGCTGGGCTTAATACCTAGGTGG + Intronic
1081009156 11:37786133-37786155 TGCTGGGCTTAATACCTAGGGGG + Intergenic
1081497510 11:43630480-43630502 TGTAGGGGATACTACCTTGGAGG + Intronic
1084085685 11:66854072-66854094 TGCAGGTTTTGGTAACTGGGGGG - Intronic
1086739918 11:90354115-90354137 TGCAGGGTCTTTTCCCTTGGGGG - Intergenic
1087287950 11:96286369-96286391 TGCCAGGTTTAATACCTAGGTGG + Intronic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1090153781 11:124414397-124414419 TGCAGGGCCTAGTACATTGTTGG + Intergenic
1090680187 11:129047419-129047441 TGTGGGGATAAGTACCTTGGGGG - Intronic
1093261358 12:16941063-16941085 TGCAGGATGTAGGGCCTTGGGGG + Intergenic
1095726812 12:45462797-45462819 TCCAGGGTTTCATACCTTGCTGG - Intergenic
1097262159 12:57726099-57726121 GGGAGGGTTTAGTACATGGGAGG - Intronic
1098024295 12:66186545-66186567 TGCTGGGCTTAATACCTAGGTGG - Intergenic
1098632389 12:72740265-72740287 TGCAGAATTTAGTTCCTTGTGGG + Intergenic
1099882934 12:88490432-88490454 TGATGGGTTTAGCACCTAGGTGG - Intergenic
1102395351 12:112581072-112581094 TGCAAGTTTTCTTACCTTGGGGG + Intronic
1104040126 12:125124395-125124417 TGCAGAGTATTGTATCTTGGGGG - Intronic
1105580489 13:21691439-21691461 TGCAGGGTTTAGAAACATGGAGG + Intronic
1106137350 13:26983595-26983617 TCCAGGGTTTTCTACCTTGATGG - Intergenic
1106887225 13:34200626-34200648 TGCAGCGTTCTGAACCTTGGGGG + Intergenic
1108372411 13:49783471-49783493 TGCAGATTTTAGTATCTTCGGGG - Intronic
1110639599 13:77807017-77807039 TCCAGGATTTAGTAACATGGTGG - Intergenic
1112660674 13:101503690-101503712 TGGAGGGGTTAGTCCCTGGGAGG + Intronic
1113218569 13:108071363-108071385 TGCAGGGTTTAATACTGTGTGGG + Intergenic
1113962992 13:114135658-114135680 TACAGGGTTTAGCCCCTGGGAGG + Intergenic
1114548068 14:23516850-23516872 TGCAGGGTTTGGTATCAGGGAGG + Intergenic
1114587294 14:23826388-23826410 GGCAGGGATCAGTCCCTTGGTGG - Intergenic
1118732389 14:68677547-68677569 TACAGGGTTTAGAACCAAGGAGG - Intronic
1120127528 14:80763824-80763846 TGCAGAGCTTATAACCTTGGAGG + Intronic
1120283634 14:82469885-82469907 TGCTAGGCTTAGTACCTAGGTGG + Intergenic
1123833525 15:24165807-24165829 GGCAGGGTTTAGAGCCATGGTGG + Intergenic
1123840259 15:24240858-24240880 GGCAGGGTTTAGAGCCATGGTGG + Intergenic
1123853197 15:24381383-24381405 GGCAGGGTTTAGAGCCATGGTGG + Intergenic
1123869166 15:24553934-24553956 GGCAGGGTTTAGAGCCATGGTGG + Intergenic
1126981295 15:54246800-54246822 TGCTGGGCTTAATACCTGGGTGG + Intronic
1130515063 15:84620044-84620066 TGCTGGGCTTAATACCTAGGTGG - Intronic
1133463455 16:6007384-6007406 GGCAGGATTCAGTTCCTTGGGGG - Intergenic
1140298767 16:73735996-73736018 TCCAGTGCTTAGTACCCTGGGGG - Intergenic
1140494010 16:75367320-75367342 TGCTGGGTTTAATACCTAGGTGG + Intronic
1142944139 17:3410560-3410582 TGCAGGGGATAGTTCCTTGCAGG - Intergenic
1146437804 17:32867463-32867485 TGCTGGGTTGGGTACTTTGGTGG - Intronic
1146505655 17:33402386-33402408 TGCTGGGCTTAATACCTAGGTGG - Intronic
1146772810 17:35584383-35584405 TACAGGATTTAGTAACATGGAGG - Intronic
1148428598 17:47622932-47622954 TGCAGGGCTTAATACATTAGTGG + Exonic
1148534343 17:48426333-48426355 GGCAGGATTTAGTACCATGTAGG + Intronic
1150238219 17:63610452-63610474 AGAAGAGTTTAGTGCCTTGGAGG + Intergenic
1151375552 17:73686383-73686405 TGCAGGGATCAGTATCCTGGGGG - Intergenic
1152909276 17:82989386-82989408 TGCAGGGCTTAATACCTAGGTGG + Intronic
1155273402 18:24163253-24163275 TGTAGGGATTAGGACCTTGATGG + Exonic
1162310443 19:9903702-9903724 TCCAGGGTTTCCTACCTTGCTGG - Intronic
1163488302 19:17602519-17602541 TCCAGGGTTCAGAACCCTGGAGG + Exonic
1163567296 19:18059219-18059241 TGCGGGGTCTTGTAGCTTGGAGG - Exonic
1164846207 19:31434714-31434736 TGCAGGGCTTAATACCTAGGTGG + Intergenic
925258859 2:2512306-2512328 TGCAGTGTTTAGAAGCCTGGAGG + Intergenic
925296370 2:2780105-2780127 TGCAGGGTGTAAAACCTGGGAGG - Intergenic
926343168 2:11921686-11921708 AGCATGGTTTAGAACTTTGGGGG - Intergenic
929007951 2:37413834-37413856 TGCAGGCTTTGGTACCTTGTGGG + Intergenic
932503271 2:72203899-72203921 TGCAGTGTATAATACCTTGAAGG - Intronic
933439314 2:82291343-82291365 TACTGGGCTTAGTACCTCGGTGG - Intergenic
936252407 2:110876792-110876814 AGCAGGGTTTGGCACCTAGGGGG - Intronic
936876547 2:117196649-117196671 TGCTGGGCTTAGTAGCTAGGTGG - Intergenic
938720094 2:134059862-134059884 TGCTGGGCTTAATACCTAGGTGG - Intergenic
940390246 2:153124152-153124174 AACAGGGTTTAGTACCTTGCAGG - Intergenic
941537000 2:166736441-166736463 TGCTGGGCTTAGTACCTAGGTGG - Intergenic
943384606 2:187185719-187185741 TGCAGAGTCTAATACCTTGCAGG - Intergenic
944203758 2:197135829-197135851 GGCAGGATTTAGTACCTAGTAGG - Intronic
944819741 2:203418456-203418478 GGCAGGATTTAGTTCCTTGTGGG + Intronic
947255713 2:228161590-228161612 TGCTGGGCTTAATACCTAGGTGG + Intronic
1169734170 20:8819662-8819684 TGCAGGTTTTGGTATCTGGGCGG - Intronic
1173281078 20:41628454-41628476 TGCATGTTTTAGTAACATGGGGG - Intergenic
1174484760 20:50854186-50854208 TCCCGGGTTTTGTATCTTGGTGG + Intronic
1175321828 20:58093578-58093600 TGCGGGGCTTAATACCTAGGTGG - Intergenic
1176345857 21:5746131-5746153 TGCAGCCTTGAGTACCCTGGGGG - Intergenic
1176352671 21:5866715-5866737 TGCAGCCTTGAGTACCCTGGGGG - Intergenic
1176498970 21:7578324-7578346 TGCAGCCTTGAGTACCCTGGGGG + Intergenic
1176540178 21:8144201-8144223 TGCAGCCTTGAGTACCCTGGGGG - Intergenic
1176559129 21:8327246-8327268 TGCAGCCTTGAGTACCCTGGGGG - Intergenic
1179459242 21:41522638-41522660 TGCTGGGCTTAATACCTAGGTGG - Intronic
1181976976 22:26737123-26737145 TTCAGGGTTTGGCATCTTGGAGG - Intergenic
1184961177 22:47929956-47929978 TCCAGGCTTTCCTACCTTGGGGG + Intergenic
1203245123 22_KI270733v1_random:60568-60590 TGCAGCCTTGAGTACCCTGGGGG - Intergenic
950832819 3:15891938-15891960 TGCAGGAGTTTGTACCTTGTGGG - Intergenic
952519737 3:34144835-34144857 TGATGGGGTGAGTACCTTGGCGG - Intergenic
954950176 3:54465483-54465505 TACAGGGTTCAGTACCATTGCGG + Intronic
957663543 3:83193268-83193290 TTCAGGGGTGAGGACCTTGGTGG - Intergenic
958467026 3:94471568-94471590 TGCAGGCTTTTTTACCTTGCAGG - Intergenic
959402495 3:105920666-105920688 TGCTGGGCTTAATACCTAGGTGG - Intergenic
959517743 3:107288450-107288472 TGCAGGAGTAATTACCTTGGTGG - Intergenic
960226255 3:115172681-115172703 TGCAGGCTTCAGTTCCTTGTGGG - Intergenic
964172819 3:153790877-153790899 TGCTGGGCTTAATACCTAGGTGG - Intergenic
964262973 3:154861094-154861116 TACATGGTTTAGTAACATGGGGG - Intergenic
964606171 3:158562589-158562611 TGCTGGGCTTAATACCTAGGTGG + Intergenic
964942568 3:162177181-162177203 TGCTGGGCTTAATACCTAGGTGG + Intergenic
968901290 4:3433158-3433180 TTCAGGGTTTAGGAGCTTGGGGG + Intronic
974258025 4:59487525-59487547 TGCCAGGTTTTATACCTTGGGGG + Intergenic
975219720 4:71800177-71800199 TGCAGGGCTTAATACCTAGAAGG - Intronic
975803656 4:78089851-78089873 TACTAGGTTTAGTACCTGGGTGG - Intronic
977510348 4:97954051-97954073 TGCAGTTTTTAGTACTTAGGAGG + Intronic
978300608 4:107265697-107265719 TGCAGAGATTAGTCCCGTGGCGG + Intronic
979281271 4:118870783-118870805 TGCAGGTCTTAATACCTAGGTGG + Intronic
979281607 4:118874964-118874986 TGCTGGGCTTAATACCTGGGTGG - Intronic
982739834 4:159045889-159045911 GGCAGGATTTGGTTCCTTGGAGG + Intergenic
986994141 5:13586885-13586907 TGCTGGGCTTAATACCTCGGTGG - Intergenic
988547569 5:32173383-32173405 TGCAGGCTTTAGGACCTGGGAGG - Intronic
989351712 5:40494253-40494275 TGCAGGGCTTAATACCTAGGTGG + Intergenic
989356548 5:40550040-40550062 TGCTGGGCTTAATACCTAGGTGG - Intergenic
994236978 5:97374297-97374319 TGCTGGGCTTAATACCTAGGTGG + Intergenic
997108591 5:131048893-131048915 TGCAGGGCTTAATAACTAGGTGG + Intergenic
999672427 5:153969292-153969314 TCCAGGGTCTAGCACCTTGTAGG + Intergenic
1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG + Intronic
1009877928 6:69529527-69529549 TGAGGGGTTTAGTTCCTTGCTGG + Intergenic
1010166193 6:72917855-72917877 TCCAGGGTATAGTAACTTGAAGG - Intronic
1015379624 6:132551596-132551618 TGCAGGTTGTAATCCCTTGGGGG + Intergenic
1015508626 6:134015359-134015381 TGCTGGGCTTAATACCTAGGTGG + Intronic
1019883160 7:3881198-3881220 TGCTGGGCTTAATACCTAGGTGG - Intronic
1022217379 7:28277911-28277933 TGCTGGGTTAAGAACCTTAGAGG + Intergenic
1026256202 7:68714107-68714129 TGCTGGGCTTAATACCTAGGTGG - Intergenic
1027492627 7:78848516-78848538 TGCAGGGTTGAGTCCCTTTCAGG - Intronic
1027941701 7:84690683-84690705 TGGAGTGTTTAGTATCTGGGAGG + Intergenic
1028331162 7:89593913-89593935 TACAAGGTTTAGTAGCTTTGAGG + Intergenic
1031121893 7:117731409-117731431 TGTAGGATTTGGGACCTTGGAGG - Intronic
1031518905 7:122738311-122738333 TGCAGGGCTTAGTGCCTAGAAGG - Intronic
1031806739 7:126316641-126316663 TGCAGGGTTTTGGACTTGGGTGG - Intergenic
1032621624 7:133539648-133539670 TGCATGATTTAATAACTTGGAGG + Intronic
1034089562 7:148351419-148351441 TGCATTGTTTAGTACCCTGTTGG + Intronic
1034858617 7:154577254-154577276 TGCAGCGTTTAGAACATGGGAGG + Intronic
1037069502 8:14626252-14626274 TGCGGGGCTTAATACCTAGGTGG - Intronic
1038646411 8:29365869-29365891 TGCAGGGCTTAGCAGCTGGGGGG - Intergenic
1042679740 8:71369667-71369689 TCCAGGGTTTAGCACATAGGAGG + Intergenic
1046818994 8:118616171-118616193 TGCAGGGATAAGTACCTATGAGG + Intronic
1049543386 8:143218501-143218523 TGCAGGCTTTCGTACCTCGGGGG - Intergenic
1052568558 9:30190221-30190243 TGCTGGGCTTAGTACCTAGGTGG - Intergenic
1052879328 9:33591162-33591184 TGCAGGGTTTAGTCCCTTGGTGG + Intergenic
1053496648 9:38553055-38553077 TGCAGGGTTTAGTACCTTGGCGG - Intronic
1055234606 9:74105392-74105414 TGCTGGGCTTAATACCTAGGTGG + Intergenic
1057676566 9:97140616-97140638 TTCAGTGTTTAGTCCCATGGCGG - Intergenic
1059144949 9:111891130-111891152 CCCAGGGTTTAGCACCTTGTGGG - Intergenic
1059709427 9:116854230-116854252 TGCAGGGTTGAGTATGGTGGTGG - Intronic
1060518886 9:124282787-124282809 TGCAGCGTTTGGTCCTTTGGTGG + Intronic
1203461456 Un_GL000220v1:43637-43659 TGCAGCCTTGAGTACCCTGGGGG - Intergenic
1185799595 X:2998067-2998089 TGCTGGGCTTAATACCTAGGTGG - Intergenic
1186106611 X:6214369-6214391 TGCAGGAGTTAGTCTCTTGGAGG - Intronic
1191046367 X:56142238-56142260 TACTGGATTTAGTAACTTGGAGG - Intergenic
1194168937 X:90557626-90557648 TGCAGGGTTCAGCTCCATGGAGG - Intergenic
1195588701 X:106598827-106598849 TGCTGGGCTTAATACCTAGGTGG + Intergenic
1195768696 X:108324864-108324886 TGCTGGGTTTTGTACTTTGTAGG - Intronic
1197013499 X:121595356-121595378 TGCAGATTTTAGTATCTTGTTGG - Intergenic
1197339938 X:125255208-125255230 TGAAGAGGTTAGTACCTTAGTGG - Intergenic
1197982367 X:132230279-132230301 TGCGGGGCTTAATACCTAGGTGG - Intergenic
1198884167 X:141315698-141315720 TGCTGGGCTTAATACCTGGGTGG - Intergenic
1199249890 X:145648611-145648633 TGGAGATTTTAGTACCATGGTGG + Intergenic
1200515180 Y:4135411-4135433 TGCAGGGTTCAGCTCCATGGAGG - Intergenic