ID: 1053503769

View in Genome Browser
Species Human (GRCh38)
Location 9:38622368-38622390
Sequence CACAAGGAGCTGCATCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053503769_1053503775 -4 Left 1053503769 9:38622368-38622390 CCTGCTGGATGCAGCTCCTTGTG No data
Right 1053503775 9:38622387-38622409 TGTGGGCCTACCAGGCTTGGTGG No data
1053503769_1053503781 30 Left 1053503769 9:38622368-38622390 CCTGCTGGATGCAGCTCCTTGTG No data
Right 1053503781 9:38622421-38622443 ACCTGTGGAGAGGAAGAGTAAGG No data
1053503769_1053503774 -7 Left 1053503769 9:38622368-38622390 CCTGCTGGATGCAGCTCCTTGTG No data
Right 1053503774 9:38622384-38622406 CCTTGTGGGCCTACCAGGCTTGG No data
1053503769_1053503778 15 Left 1053503769 9:38622368-38622390 CCTGCTGGATGCAGCTCCTTGTG No data
Right 1053503778 9:38622406-38622428 GTGGAGCCACAGCAGACCTGTGG No data
1053503769_1053503779 20 Left 1053503769 9:38622368-38622390 CCTGCTGGATGCAGCTCCTTGTG No data
Right 1053503779 9:38622411-38622433 GCCACAGCAGACCTGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053503769 Original CRISPR CACAAGGAGCTGCATCCAGC AGG (reversed) Intergenic
No off target data available for this crispr