ID: 1053510914

View in Genome Browser
Species Human (GRCh38)
Location 9:38687077-38687099
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053510914_1053510922 5 Left 1053510914 9:38687077-38687099 CCCCATCCCGGCACTGGGACTGC No data
Right 1053510922 9:38687105-38687127 ATCCACGAAGAACTCCAGCAGGG No data
1053510914_1053510926 22 Left 1053510914 9:38687077-38687099 CCCCATCCCGGCACTGGGACTGC No data
Right 1053510926 9:38687122-38687144 GCAGGGCTAAGAGGACAGTGTGG No data
1053510914_1053510921 4 Left 1053510914 9:38687077-38687099 CCCCATCCCGGCACTGGGACTGC No data
Right 1053510921 9:38687104-38687126 CATCCACGAAGAACTCCAGCAGG No data
1053510914_1053510927 25 Left 1053510914 9:38687077-38687099 CCCCATCCCGGCACTGGGACTGC No data
Right 1053510927 9:38687125-38687147 GGGCTAAGAGGACAGTGTGGAGG No data
1053510914_1053510924 13 Left 1053510914 9:38687077-38687099 CCCCATCCCGGCACTGGGACTGC No data
Right 1053510924 9:38687113-38687135 AGAACTCCAGCAGGGCTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053510914 Original CRISPR GCAGTCCCAGTGCCGGGATG GGG (reversed) Intergenic
No off target data available for this crispr