ID: 1053510922

View in Genome Browser
Species Human (GRCh38)
Location 9:38687105-38687127
Sequence ATCCACGAAGAACTCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053510918_1053510922 -2 Left 1053510918 9:38687084-38687106 CCGGCACTGGGACTGCAGCCCAT No data
Right 1053510922 9:38687105-38687127 ATCCACGAAGAACTCCAGCAGGG No data
1053510911_1053510922 16 Left 1053510911 9:38687066-38687088 CCGCAGGAAGGCCCCATCCCGGC No data
Right 1053510922 9:38687105-38687127 ATCCACGAAGAACTCCAGCAGGG No data
1053510917_1053510922 -1 Left 1053510917 9:38687083-38687105 CCCGGCACTGGGACTGCAGCCCA No data
Right 1053510922 9:38687105-38687127 ATCCACGAAGAACTCCAGCAGGG No data
1053510916_1053510922 3 Left 1053510916 9:38687079-38687101 CCATCCCGGCACTGGGACTGCAG No data
Right 1053510922 9:38687105-38687127 ATCCACGAAGAACTCCAGCAGGG No data
1053510915_1053510922 4 Left 1053510915 9:38687078-38687100 CCCATCCCGGCACTGGGACTGCA No data
Right 1053510922 9:38687105-38687127 ATCCACGAAGAACTCCAGCAGGG No data
1053510914_1053510922 5 Left 1053510914 9:38687077-38687099 CCCCATCCCGGCACTGGGACTGC No data
Right 1053510922 9:38687105-38687127 ATCCACGAAGAACTCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053510922 Original CRISPR ATCCACGAAGAACTCCAGCA GGG Intergenic
No off target data available for this crispr