ID: 1053511676

View in Genome Browser
Species Human (GRCh38)
Location 9:38693198-38693220
Sequence CATGGGAATGAACATCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053511676_1053511686 29 Left 1053511676 9:38693198-38693220 CCTTCCTGATGTTCATTCCCATG No data
Right 1053511686 9:38693250-38693272 TTTTTTTTTTTTTTTTCAGATGG 0: 732
1: 89303
2: 64679
3: 85396
4: 154474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053511676 Original CRISPR CATGGGAATGAACATCAGGA AGG (reversed) Intergenic
No off target data available for this crispr