ID: 1053516692

View in Genome Browser
Species Human (GRCh38)
Location 9:38736227-38736249
Sequence AGTCACCCCCTTCCAAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053516692_1053516701 20 Left 1053516692 9:38736227-38736249 CCAGGCCTTGGAAGGGGGTGACT No data
Right 1053516701 9:38736270-38736292 CATATCAATGACCATATCTGAGG No data
1053516692_1053516703 30 Left 1053516692 9:38736227-38736249 CCAGGCCTTGGAAGGGGGTGACT No data
Right 1053516703 9:38736280-38736302 ACCATATCTGAGGCCCAGATGGG No data
1053516692_1053516702 29 Left 1053516692 9:38736227-38736249 CCAGGCCTTGGAAGGGGGTGACT No data
Right 1053516702 9:38736279-38736301 GACCATATCTGAGGCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053516692 Original CRISPR AGTCACCCCCTTCCAAGGCC TGG (reversed) Intergenic
No off target data available for this crispr