ID: 1053519603

View in Genome Browser
Species Human (GRCh38)
Location 9:38764397-38764419
Sequence CATCATGGTGGAAGATGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053519603_1053519607 -8 Left 1053519603 9:38764397-38764419 CCTGTTCATCTTCCACCATGATG No data
Right 1053519607 9:38764412-38764434 CCATGATGGTAAATTTTCAGAGG No data
1053519603_1053519612 24 Left 1053519603 9:38764397-38764419 CCTGTTCATCTTCCACCATGATG No data
Right 1053519612 9:38764444-38764466 CACTCTTCTTGTTAAGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053519603 Original CRISPR CATCATGGTGGAAGATGAAC AGG (reversed) Intergenic
No off target data available for this crispr