ID: 1053519698

View in Genome Browser
Species Human (GRCh38)
Location 9:38765122-38765144
Sequence CAACACTCCTTGGGCACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053519695_1053519698 4 Left 1053519695 9:38765095-38765117 CCTATAATGCTTTGAGTAGTTGA No data
Right 1053519698 9:38765122-38765144 CAACACTCCTTGGGCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053519698 Original CRISPR CAACACTCCTTGGGCACCAC TGG Intergenic
No off target data available for this crispr