ID: 1053523225

View in Genome Browser
Species Human (GRCh38)
Location 9:38803182-38803204
Sequence GAGTGGAAGCAGCATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053523225_1053523233 -3 Left 1053523225 9:38803182-38803204 CCTCCCTCATGCTGCTTCCACTC No data
Right 1053523233 9:38803202-38803224 CTCATGGCAGAAAGTGGATGGGG No data
1053523225_1053523236 25 Left 1053523225 9:38803182-38803204 CCTCCCTCATGCTGCTTCCACTC No data
Right 1053523236 9:38803230-38803252 GCGTGTGCAAAGAGATCACGTGG No data
1053523225_1053523232 -4 Left 1053523225 9:38803182-38803204 CCTCCCTCATGCTGCTTCCACTC No data
Right 1053523232 9:38803201-38803223 ACTCATGGCAGAAAGTGGATGGG No data
1053523225_1053523234 2 Left 1053523225 9:38803182-38803204 CCTCCCTCATGCTGCTTCCACTC No data
Right 1053523234 9:38803207-38803229 GGCAGAAAGTGGATGGGGTGTGG No data
1053523225_1053523231 -5 Left 1053523225 9:38803182-38803204 CCTCCCTCATGCTGCTTCCACTC No data
Right 1053523231 9:38803200-38803222 CACTCATGGCAGAAAGTGGATGG No data
1053523225_1053523229 -9 Left 1053523225 9:38803182-38803204 CCTCCCTCATGCTGCTTCCACTC No data
Right 1053523229 9:38803196-38803218 CTTCCACTCATGGCAGAAAGTGG 0: 7
1: 19
2: 55
3: 179
4: 499
1053523225_1053523235 3 Left 1053523225 9:38803182-38803204 CCTCCCTCATGCTGCTTCCACTC No data
Right 1053523235 9:38803208-38803230 GCAGAAAGTGGATGGGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053523225 Original CRISPR GAGTGGAAGCAGCATGAGGG AGG (reversed) Intergenic
No off target data available for this crispr