ID: 1053524359

View in Genome Browser
Species Human (GRCh38)
Location 9:38813596-38813618
Sequence CTTTGTAAGGTGAGGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053524359_1053524365 12 Left 1053524359 9:38813596-38813618 CCTTTCTGCCTCACCTTACAAAG No data
Right 1053524365 9:38813631-38813653 GTTTGGGATTAATGTTGAGATGG No data
1053524359_1053524366 13 Left 1053524359 9:38813596-38813618 CCTTTCTGCCTCACCTTACAAAG No data
Right 1053524366 9:38813632-38813654 TTTGGGATTAATGTTGAGATGGG No data
1053524359_1053524363 -5 Left 1053524359 9:38813596-38813618 CCTTTCTGCCTCACCTTACAAAG No data
Right 1053524363 9:38813614-38813636 CAAAGGTACTTTACAAAGTTTGG No data
1053524359_1053524364 -4 Left 1053524359 9:38813596-38813618 CCTTTCTGCCTCACCTTACAAAG No data
Right 1053524364 9:38813615-38813637 AAAGGTACTTTACAAAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053524359 Original CRISPR CTTTGTAAGGTGAGGCAGAA AGG (reversed) Intergenic
No off target data available for this crispr