ID: 1053524364

View in Genome Browser
Species Human (GRCh38)
Location 9:38813615-38813637
Sequence AAAGGTACTTTACAAAGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053524358_1053524364 19 Left 1053524358 9:38813573-38813595 CCTGGGCTAACTGATGAAATCAG No data
Right 1053524364 9:38813615-38813637 AAAGGTACTTTACAAAGTTTGGG No data
1053524359_1053524364 -4 Left 1053524359 9:38813596-38813618 CCTTTCTGCCTCACCTTACAAAG No data
Right 1053524364 9:38813615-38813637 AAAGGTACTTTACAAAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053524364 Original CRISPR AAAGGTACTTTACAAAGTTT GGG Intergenic
No off target data available for this crispr