ID: 1053524365

View in Genome Browser
Species Human (GRCh38)
Location 9:38813631-38813653
Sequence GTTTGGGATTAATGTTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053524362_1053524365 -1 Left 1053524362 9:38813609-38813631 CCTTACAAAGGTACTTTACAAAG No data
Right 1053524365 9:38813631-38813653 GTTTGGGATTAATGTTGAGATGG No data
1053524361_1053524365 4 Left 1053524361 9:38813604-38813626 CCTCACCTTACAAAGGTACTTTA No data
Right 1053524365 9:38813631-38813653 GTTTGGGATTAATGTTGAGATGG No data
1053524359_1053524365 12 Left 1053524359 9:38813596-38813618 CCTTTCTGCCTCACCTTACAAAG No data
Right 1053524365 9:38813631-38813653 GTTTGGGATTAATGTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053524365 Original CRISPR GTTTGGGATTAATGTTGAGA TGG Intergenic
No off target data available for this crispr