ID: 1053527885

View in Genome Browser
Species Human (GRCh38)
Location 9:38847935-38847957
Sequence CAGTGCTAAAACAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053527885_1053527890 -4 Left 1053527885 9:38847935-38847957 CCCTCTTCCCTGTTTTAGCACTG No data
Right 1053527890 9:38847954-38847976 ACTGGTTGATACTGAGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053527885 Original CRISPR CAGTGCTAAAACAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr