ID: 1053528791

View in Genome Browser
Species Human (GRCh38)
Location 9:38857078-38857100
Sequence ATGAAGAAGCCAACTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053528786_1053528791 14 Left 1053528786 9:38857041-38857063 CCAACGGTTTCCATGAAAGGAGG No data
Right 1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG No data
1053528789_1053528791 4 Left 1053528789 9:38857051-38857073 CCATGAAAGGAGGATGTGGTCAC No data
Right 1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053528791 Original CRISPR ATGAAGAAGCCAACTGAGGA AGG Intergenic
No off target data available for this crispr