ID: 1053530019

View in Genome Browser
Species Human (GRCh38)
Location 9:38871229-38871251
Sequence ACATCCTGCATCTAACTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053530019_1053530023 25 Left 1053530019 9:38871229-38871251 CCACTTAGTTAGATGCAGGATGT No data
Right 1053530023 9:38871277-38871299 CTGAGTATTATCTACAAGTTAGG No data
1053530019_1053530021 -9 Left 1053530019 9:38871229-38871251 CCACTTAGTTAGATGCAGGATGT No data
Right 1053530021 9:38871243-38871265 GCAGGATGTGATGTATTTTAGGG No data
1053530019_1053530020 -10 Left 1053530019 9:38871229-38871251 CCACTTAGTTAGATGCAGGATGT No data
Right 1053530020 9:38871242-38871264 TGCAGGATGTGATGTATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053530019 Original CRISPR ACATCCTGCATCTAACTAAG TGG (reversed) Intergenic
No off target data available for this crispr