ID: 1053530023

View in Genome Browser
Species Human (GRCh38)
Location 9:38871277-38871299
Sequence CTGAGTATTATCTACAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053530019_1053530023 25 Left 1053530019 9:38871229-38871251 CCACTTAGTTAGATGCAGGATGT No data
Right 1053530023 9:38871277-38871299 CTGAGTATTATCTACAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053530023 Original CRISPR CTGAGTATTATCTACAAGTT AGG Intergenic
No off target data available for this crispr