ID: 1053530856

View in Genome Browser
Species Human (GRCh38)
Location 9:38879413-38879435
Sequence TGCCAGTGCAAAATTGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053530852_1053530856 -6 Left 1053530852 9:38879396-38879418 CCCTGTGCCAACACTGCTGCCAG No data
Right 1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG No data
1053530850_1053530856 -1 Left 1053530850 9:38879391-38879413 CCTGCCCCTGTGCCAACACTGCT No data
Right 1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG No data
1053530851_1053530856 -5 Left 1053530851 9:38879395-38879417 CCCCTGTGCCAACACTGCTGCCA No data
Right 1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG No data
1053530846_1053530856 12 Left 1053530846 9:38879378-38879400 CCTCCACCAGCACCCTGCCCCTG No data
Right 1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG No data
1053530844_1053530856 17 Left 1053530844 9:38879373-38879395 CCTTCCCTCCACCAGCACCCTGC No data
Right 1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG No data
1053530853_1053530856 -7 Left 1053530853 9:38879397-38879419 CCTGTGCCAACACTGCTGCCAGT No data
Right 1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG No data
1053530848_1053530856 6 Left 1053530848 9:38879384-38879406 CCAGCACCCTGCCCCTGTGCCAA 0: 4
1: 5
2: 27
3: 88
4: 451
Right 1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG No data
1053530843_1053530856 25 Left 1053530843 9:38879365-38879387 CCTATGAGCCTTCCCTCCACCAG No data
Right 1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG No data
1053530847_1053530856 9 Left 1053530847 9:38879381-38879403 CCACCAGCACCCTGCCCCTGTGC No data
Right 1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG No data
1053530845_1053530856 13 Left 1053530845 9:38879377-38879399 CCCTCCACCAGCACCCTGCCCCT No data
Right 1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG No data
1053530849_1053530856 0 Left 1053530849 9:38879390-38879412 CCCTGCCCCTGTGCCAACACTGC No data
Right 1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053530856 Original CRISPR TGCCAGTGCAAAATTGGACA TGG Intergenic
No off target data available for this crispr