ID: 1053531466

View in Genome Browser
Species Human (GRCh38)
Location 9:38886477-38886499
Sequence CCTAGGATAAAGTAGTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053531466_1053531477 22 Left 1053531466 9:38886477-38886499 CCTGTGTACTACTTTATCCTAGG No data
Right 1053531477 9:38886522-38886544 CCTAGGATAAAGGCATTTTGGGG No data
1053531466_1053531475 21 Left 1053531466 9:38886477-38886499 CCTGTGTACTACTTTATCCTAGG No data
Right 1053531475 9:38886521-38886543 GCCTAGGATAAAGGCATTTTGGG No data
1053531466_1053531478 23 Left 1053531466 9:38886477-38886499 CCTGTGTACTACTTTATCCTAGG No data
Right 1053531478 9:38886523-38886545 CTAGGATAAAGGCATTTTGGGGG No data
1053531466_1053531473 12 Left 1053531466 9:38886477-38886499 CCTGTGTACTACTTTATCCTAGG No data
Right 1053531473 9:38886512-38886534 CATCAAAATGCCTAGGATAAAGG No data
1053531466_1053531474 20 Left 1053531466 9:38886477-38886499 CCTGTGTACTACTTTATCCTAGG No data
Right 1053531474 9:38886520-38886542 TGCCTAGGATAAAGGCATTTTGG No data
1053531466_1053531472 5 Left 1053531466 9:38886477-38886499 CCTGTGTACTACTTTATCCTAGG No data
Right 1053531472 9:38886505-38886527 TGGGGAACATCAAAATGCCTAGG No data
1053531466_1053531479 24 Left 1053531466 9:38886477-38886499 CCTGTGTACTACTTTATCCTAGG No data
Right 1053531479 9:38886524-38886546 TAGGATAAAGGCATTTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053531466 Original CRISPR CCTAGGATAAAGTAGTACAC AGG (reversed) Intergenic