ID: 1053531471

View in Genome Browser
Species Human (GRCh38)
Location 9:38886494-38886516
Sequence TGATGTTCCCCAAAATGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053531471_1053531473 -5 Left 1053531471 9:38886494-38886516 CCTAGGCATTTTGGGGAACATCA No data
Right 1053531473 9:38886512-38886534 CATCAAAATGCCTAGGATAAAGG No data
1053531471_1053531477 5 Left 1053531471 9:38886494-38886516 CCTAGGCATTTTGGGGAACATCA No data
Right 1053531477 9:38886522-38886544 CCTAGGATAAAGGCATTTTGGGG No data
1053531471_1053531474 3 Left 1053531471 9:38886494-38886516 CCTAGGCATTTTGGGGAACATCA No data
Right 1053531474 9:38886520-38886542 TGCCTAGGATAAAGGCATTTTGG No data
1053531471_1053531479 7 Left 1053531471 9:38886494-38886516 CCTAGGCATTTTGGGGAACATCA No data
Right 1053531479 9:38886524-38886546 TAGGATAAAGGCATTTTGGGGGG No data
1053531471_1053531478 6 Left 1053531471 9:38886494-38886516 CCTAGGCATTTTGGGGAACATCA No data
Right 1053531478 9:38886523-38886545 CTAGGATAAAGGCATTTTGGGGG No data
1053531471_1053531475 4 Left 1053531471 9:38886494-38886516 CCTAGGCATTTTGGGGAACATCA No data
Right 1053531475 9:38886521-38886543 GCCTAGGATAAAGGCATTTTGGG No data
1053531471_1053531480 25 Left 1053531471 9:38886494-38886516 CCTAGGCATTTTGGGGAACATCA No data
Right 1053531480 9:38886542-38886564 GGGGGCCATCAAAAAAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053531471 Original CRISPR TGATGTTCCCCAAAATGCCT AGG (reversed) Intergenic