ID: 1053531474

View in Genome Browser
Species Human (GRCh38)
Location 9:38886520-38886542
Sequence TGCCTAGGATAAAGGCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053531466_1053531474 20 Left 1053531466 9:38886477-38886499 CCTGTGTACTACTTTATCCTAGG No data
Right 1053531474 9:38886520-38886542 TGCCTAGGATAAAGGCATTTTGG No data
1053531471_1053531474 3 Left 1053531471 9:38886494-38886516 CCTAGGCATTTTGGGGAACATCA No data
Right 1053531474 9:38886520-38886542 TGCCTAGGATAAAGGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053531474 Original CRISPR TGCCTAGGATAAAGGCATTT TGG Intergenic