ID: 1053537275

View in Genome Browser
Species Human (GRCh38)
Location 9:38938117-38938139
Sequence AGGGGCTCCCAGATTCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053537275_1053537281 19 Left 1053537275 9:38938117-38938139 CCATGAGGAATCTGGGAGCCCCT No data
Right 1053537281 9:38938159-38938181 ACATAAAAAAGTGAGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053537275 Original CRISPR AGGGGCTCCCAGATTCCTCA TGG (reversed) Intergenic
No off target data available for this crispr