ID: 1053542925

View in Genome Browser
Species Human (GRCh38)
Location 9:38993555-38993577
Sequence CTCCAACAGTAATGGCAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053542923_1053542925 -10 Left 1053542923 9:38993542-38993564 CCACTCATCAATGCTCCAACAGT No data
Right 1053542925 9:38993555-38993577 CTCCAACAGTAATGGCAGTATGG No data
1053542922_1053542925 -9 Left 1053542922 9:38993541-38993563 CCCACTCATCAATGCTCCAACAG No data
Right 1053542925 9:38993555-38993577 CTCCAACAGTAATGGCAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053542925 Original CRISPR CTCCAACAGTAATGGCAGTA TGG Intergenic
No off target data available for this crispr