ID: 1053543928

View in Genome Browser
Species Human (GRCh38)
Location 9:39003306-39003328
Sequence CACTGTGCCCAGGGAGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053543928_1053543934 25 Left 1053543928 9:39003306-39003328 CCATCAACTCCCTGGGCACAGTG No data
Right 1053543934 9:39003354-39003376 CGCCCAGCTACTCTTGATGCTGG No data
1053543928_1053543931 -9 Left 1053543928 9:39003306-39003328 CCATCAACTCCCTGGGCACAGTG No data
Right 1053543931 9:39003320-39003342 GGCACAGTGACACCATCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053543928 Original CRISPR CACTGTGCCCAGGGAGTTGA TGG (reversed) Intergenic
No off target data available for this crispr