ID: 1053544582

View in Genome Browser
Species Human (GRCh38)
Location 9:39009644-39009666
Sequence AGAATAGCCCCTATGAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053544573_1053544582 16 Left 1053544573 9:39009605-39009627 CCAGCCTCATAAACTCAGGTTCT No data
Right 1053544582 9:39009644-39009666 AGAATAGCCCCTATGAACTCAGG No data
1053544576_1053544582 12 Left 1053544576 9:39009609-39009631 CCTCATAAACTCAGGTTCTGGGC No data
Right 1053544582 9:39009644-39009666 AGAATAGCCCCTATGAACTCAGG No data
1053544577_1053544582 -10 Left 1053544577 9:39009631-39009653 CCCACCCAGTACCAGAATAGCCC No data
Right 1053544582 9:39009644-39009666 AGAATAGCCCCTATGAACTCAGG No data
1053544572_1053544582 17 Left 1053544572 9:39009604-39009626 CCCAGCCTCATAAACTCAGGTTC No data
Right 1053544582 9:39009644-39009666 AGAATAGCCCCTATGAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053544582 Original CRISPR AGAATAGCCCCTATGAACTC AGG Intergenic
No off target data available for this crispr